KIAA0608

Product ID	ORK00574
Accession No	AB011180
Description	TBC1 domain family, member 12
Clone name	hh00889b
Vector information	The cDNA fragment was inserted at the NotI site of the The cDNA fragment was inserted at the NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA (NotI site) was ligated with the NotI site of the vector without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector. The cDNA was cloned into the vector in the direction of KpnI site to SacI site of the vector.
cDNA sequence	DNA sequence (3344 bp) Predicted protein sequence (775 aa)
HaloTag ORF Clone	FHC00574
Flexi ORF Clone	FXC00574
Source	Human adult brain
Rouge ID	mKIAA0608 by Kazusa Mouse cDNA Project

Length: 3344 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1015 bp
Genome contig ID	gi89161187f_96052342
PolyA signal sequence (None)	+--------+--------+----*----+---- ATGCATAATTTTTCCTAATCAGTGGAAATAAGAAT
Flanking genome sequence (231518 - 231567)	----+--------+--------+--------+--------+----* AAAAGAAAAAGGTAAAGTTAATTTTTTTTCTAAGTCTACATCCTATCTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	96152342	96283858	14	99.7	Perfect prediction

Length: 775 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_507936	0	100.0	TBC1 domain fam...	Pan troglodytes
BAG09776	0	100.0	TBC1 domain fam...	synthetic construct
O60347	0	99.2	TBC1 domain fam...	Homo sapiens
XP_849591	0	86.3	similar to TBC1...	Canis lupus fam...
XP_001090278	1.3e-213	87.6	TBC1 domain fam...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037743	1.1e-77	70.6	KIAA1322
D13644	2.5e-08	28.1	KIAA0019
AB029031	2.1e-07	21.7	KIAA1108
AB011175	1.1e-06	22.3	KIAA0603
AB028978	9.6e-05	24.4	KIAA1055

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	483	714	PF00566	RabGAP/TBC
HMMSmart	IPR000195	481	715	SM00164	RabGAP/TBC
ProfileScan	IPR000195	484	692	PS50086	RabGAP/TBC

Primer_f	GACATTGTTTCCAGTTCTGAC
Primer_r	CTAGGTAACTCGAATTTGCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GACATTGTTTCCAGTTCTGAC
Primer_r	CTAGGTAACTCGAATTTGCCC
PCR product length	222 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles