KIAA0819

Gene/Protein Characteristic Table for KIAA0819

Order Kazusa clone(s) from :

Product ID	ORK05623
Accession No	AB020626
Description	microtubule associated monooxygenase, calponin and LIM domain containing 3
Clone name	hh01037
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6049 bp) Predicted protein sequence (989 aa)
Source	Human adult brain
Rouge ID	mKIAA0819 by Kazusa Mouse cDNA Project

Length: 6049 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3079 bp
Genome contig ID	gi89161203r_16550418
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GGGTCTGTTTTATGCAAAATAAAAGTTTTTCAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATAGTGTGTTTCTTAAGTCATTTTACTGTATTTTTCAGGTGGATGGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	16650418	16694635	12	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 989 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_056056	99.9	microtubule ass...	Homo sapiens
EAW57777	99.9	hCG21537 [Homo ...	Homo sapiens
XP_514968	98.8	microtubule ass...	Pan troglodytes
BAG10388	96.8	MICAL-3 protein...	synthetic construct
XP_001111763	95.3	similar to Prot...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051455	0.00016	27.5	KIAA1668

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CTCCAGGCAGGTTTTCTCTCG
Primer_r	TTCAGCCTCCAGTTTAGTCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 22

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTCCAGGCAGGTTTTCTCTCG
Primer_r	TTCAGCCTCCAGTTTAGTCAG
PCR product length	138 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp