Order Kazusa clone(s) from : ![]() |
Product ID | ORK00170 |
---|---|
Accession No | AB028970 |
Description | nuclear receptor corepressor 1, transcript variant 3 |
Clone name | hh01221s1 |
Vector information | |
cDNA sequence | DNA sequence (7949 bp) Predicted protein sequence (2348 aa) |
HaloTag ORF Clone |
FHC00170
![]() |
Flexi ORF Clone | FXC00170 |
Source | Human adult brain |
Rouge ID |
mKIAA1047
by Kazusa Mouse cDNA Project
|
Note | We replaced hh01221, former representative clones for KIAA1047 with hh01221s1. (2003/4/2) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 891 bp |
---|---|
Genome contig ID | gi51511734r_15775444 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 15875444 | 16038652 | 45 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | GTGCGTAACAGTGAGGTATGC |
---|---|
Primer_r | TTGTAAATTTCCAGTGCAGGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTGTAAATTTCCAGTGCAGGC |
Primer_r | GTGCGTAACAGTGAGGTATGC |
PCR product length | 135 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |