KIAA1047

Product ID	ORK00170
Accession No	AB028970
Description	nuclear receptor corepressor 1, transcript variant 3
Clone name	hh01221s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-1691) was subcloned upstream of the cDNA (1692-7949). The adjacent sequence to the 5' end of the cDNA is as follows: GGTACCACAA GTTTGTACAA AAAAGCAGGC TGTCGACGGT ATCGATAAGC TTGATT-5' end of cDNA This cDNA clone hh01221s1 has an unexpected insertion (T) between the vector and the cDNA.
cDNA sequence	DNA sequence (7949 bp) Predicted protein sequence (2348 aa)
HaloTag ORF Clone	FHC00170
Flexi ORF Clone	FXC00170
Source	Human adult brain
Rouge ID	mKIAA1047 by Kazusa Mouse cDNA Project
Note	We replaced hh01221, former representative clones for KIAA1047 with hh01221s1. (2003/4/2)

Length: 7949 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	891 bp
Genome contig ID	gi51511734r_15775444
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTTTGTTTTGAAATAAATTTGACTACCCTGTCCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCTACAGTAGATTATTTGTGGTTTAAGGCTCCTGGTGTCTCAGGTTCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	15875444	16038652	45	100.0	Perfect prediction

Length: 2348 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX04494	100.0	nuclear recepto...	Homo sapiens
XP_863820	94.7	similar to nucl...	Canis lupus fam...
CAI24058	91.7	nuclear recepto...	Mus musculus
XP_536653	87.7	similar to nucl...	Canis lupus fam...
XP_851485	90.1	similar to nucl...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D31888	0.00027	25.8	KIAA0071

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014778	448	493	PF00249	Myb
HMMPfam	IPR014778	636	681	PF00249	Myb
HMMSmart	IPR001005	447	495	SM00717	SANT
HMMSmart	IPR001005	635	683	SM00717	SANT
ProfileScan	IPR001005	631	681	PS50090	SANT

Primer_f	GTGCGTAACAGTGAGGTATGC
Primer_r	TTGTAAATTTCCAGTGCAGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTGTAAATTTCCAGTGCAGGC
Primer_r	GTGCGTAACAGTGAGGTATGC
PCR product length	135 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles