|
Order Kazusa clone(s) from : |
| Product ID | ORK07653 |
|---|---|
| Accession No | AB011136 |
| Description | von Willebrand factor A domain containing 8 |
| Clone name | hh01811 |
| Vector information | |
| cDNA sequence | DNA sequence (5688 bp) Predicted protein sequence (1441 aa) |
| Source | Human adult brain |
| Rouge ID |
mKIAA0564
by Kazusa Mouse cDNA Project
|
Length: 5688 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 1441 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR011704 | 1 | 147 | PF07728 | ATPase associated with various cellular activities |
| IPR011704 | 312 | 467 | PF07728 | ATPase associated with various cellular activities | |
| HMMSmart | IPR002035 | 1248 | 1437 | SM00327 | von Willebrand factor |
| ProfileScan | IPR002035 | 1250 | 1432 | PS50234 | von Willebrand factor |
RT-PCR
|
|---|
Experimental conditions| Primer_f | TAGGGAGAGGGGTGATAGAAC |
|---|---|
| Primer_r | AAACGTTAGGGCACCAGTGAG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 13
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | TAGGGAGAGGGGTGATAGAAC |
| Primer_r | AAACGTTAGGGCACCAGTGAG |
| PCR product length | 177 bp |
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |