Gene/Protein Characteristic Table for KIAA0564
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07653
Accession No AB011136
Description von Willebrand factor A domain containing 8
Clone name hh01811
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5688 bp)
Predicted protein sequence (1441 aa)
Source Human adult brain
Rouge ID mKIAA0564 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5688 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1441 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAI39586 0 100.0 novel protein [...
Homo sapiens
XP_001091849 0 98.2 similar to F11C...
Macaca mulatta
XP_848634 0 92.8 similar to F11C...
Canis lupus fam...
XP_214237 0 86.5 similar to F11C...
Rattus norvegicus
XP_920456 0 85.8 hypothetical pr...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR011704 1 147 PF07728 ATPase associated with various cellular activities
IPR011704 312 467 PF07728 ATPase associated with various cellular activities
HMMSmart IPR002035 1248 1437 SM00327 von Willebrand factor
ProfileScan IPR002035 1250 1432 PS50234 von Willebrand factor
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TAGGGAGAGGGGTGATAGAAC
Primer_r AAACGTTAGGGCACCAGTGAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 13
Experimental conditions
Panel name GeneBridge 4
Primer_f TAGGGAGAGGGGTGATAGAAC
Primer_r AAACGTTAGGGCACCAGTGAG
PCR product length 177 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp