Gene/Protein Characteristic Table for KIAA0567
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00099
Accession No AB011139
Description optic atrophy 1 (autosomal dominant), transcript variant 1
Clone name hh02110
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5864 bp)
Predicted protein sequence (978 aa)
Flexi ORF Clone FXC00099
Source Human adult brain
Rouge ID mKIAA0567 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5864 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 978 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH75805 0 100.0 Optic atrophy 1...
Homo sapiens
O60313 0 99.9 Dynamin-like 12...
Homo sapiens
Q5RAM3 0 99.5 Dynamin-like 12...
Pongo abelii
P58281 0 96.2 Dynamin-like 12...
Mus musculus
AAR04100 0 95.9 optic atrophy 1...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB020627 2.1e-14 23.4 KIAA0820
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001401 306 324 PR00195 Dynamin
IPR001401 331 348 PR00195 Dynamin
IPR001401 406 423 PR00195 Dynamin
IPR001401 475 491 PR00195 Dynamin
HMMPfam IPR001401 309 487 PF00350 Dynamin
HMMSmart IPR001401 283 533 SM00053 Dynamin
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CTCTAGCAGTATGGAAATGTG
Primer_r AGTTCATTCACAGTGCACAAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name GeneBridge 4
Primer_f CTCTAGCAGTATGGAAATGTG
Primer_r AGTTCATTCACAGTGCACAAG
PCR product length 116 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp