Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00134 |
---|---|
Accession No | AB020627 |
Description | dynamin 3, transcript variant 2 |
Clone name | bg00036 |
Vector information | |
cDNA sequence | DNA sequence (6407 bp) Predicted protein sequence (892 aa) |
HaloTag ORF Clone |
FHC00134
|
Flexi ORF Clone | FXC00134 |
Source | Human adult brain |
Rouge ID |
mKIAA0820
by Kazusa Mouse cDNA Project
|
Note | We replaced hh02540, former representative clones for KIAA0820 with bg00036. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3697 bp |
---|---|
Genome contig ID | gi89161185f_169977290 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (670013 - 670062) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 170077290 | 170647301 | 19 | 99.3 | Internal No-hit |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001401 | 64 | 82 | PR00195 | Dynamin |
IPR001401 | 89 | 106 | PR00195 | Dynamin | |
IPR001401 | 159 | 176 | PR00195 | Dynamin | |
IPR001401 | 209 | 227 | PR00195 | Dynamin | |
IPR001401 | 228 | 244 | PR00195 | Dynamin | |
IPR001401 | 251 | 270 | PR00195 | Dynamin | |
HMMPfam | IPR001401 | 67 | 240 | PF00350 | Dynamin |
IPR000375 | 249 | 542 | PF01031 | Dynamin central region | |
IPR001849 | 549 | 654 | PF00169 | Pleckstrin-like | |
IPR003130 | 677 | 768 | PF02212 | Dynamin GTPase effector | |
HMMSmart | IPR001401 | 39 | 278 | SM00053 | Dynamin |
IPR001849 | 549 | 656 | SM00233 | Pleckstrin-like | |
IPR003130 | 677 | 768 | SM00302 | Dynamin GTPase effector | |
ProfileScan | IPR001849 | 548 | 654 | PS50003 | Pleckstrin-like |
ScanRegExp | IPR001401 | 90 | 99 | PS00410 | Dynamin |
RT-PCR-ELISA |
Primer_f | CTCCAGATTGTAGTCATTTTG |
---|---|
Primer_r | GGTCTCCAGAGGTTTTACTTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGTCTCCAGAGGTTTTACTTC |
Primer_r | CTCCAGATTGTAGTCATTTTG |
PCR product length | 161 bp |
PCR conditions | 95 °C15 sec60 °C60 sec30 cycles |