KIAA0820

Product ID	ORK00134
Accession No	AB020627
Description	dynamin 3, transcript variant 2
Clone name	bg00036
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (6407 bp) Predicted protein sequence (892 aa)
HaloTag ORF Clone	FHC00134
Flexi ORF Clone	FXC00134
Source	Human adult brain
Rouge ID	mKIAA0820 by Kazusa Mouse cDNA Project
Note	We replaced hh02540, former representative clones for KIAA0820 with bg00036. (2002/5/10)

Length: 6407 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3697 bp
Genome contig ID	gi89161185f_169977290
PolyA signal sequence (None)	+--------+--------+----*----+---- GATATACATAGTCATTTTTCCTCTATGGTAGAAGT
Flanking genome sequence (670013 - 670062)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGGACATAGCAACATTAAAGTAGTGGATTTTTCTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	170077290	170647301	19	99.3	Internal No-hit

Length: 892 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH74079	100.0	dynamin 3 [Homo...	Homo sapiens
NP_056384	99.5	dynamin 3 isofo...	Homo sapiens
CAB66647	99.2	hypothetical pr...	Homo sapiens
XP_001100178	99.1	similar to dyna...	Macaca mulatta
EAW90915	99.5	dynamin 3, isof...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011139	0.00014	23.6	KIAA0567

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001401	64	82	PR00195	Dynamin
	IPR001401	89	106	PR00195	Dynamin
	IPR001401	159	176	PR00195	Dynamin
	IPR001401	209	227	PR00195	Dynamin
	IPR001401	228	244	PR00195	Dynamin
	IPR001401	251	270	PR00195	Dynamin
HMMPfam	IPR001401	67	240	PF00350	Dynamin
	IPR000375	249	542	PF01031	Dynamin central region
	IPR001849	549	654	PF00169	Pleckstrin-like
	IPR003130	677	768	PF02212	Dynamin GTPase effector
HMMSmart	IPR001401	39	278	SM00053	Dynamin
	IPR001849	549	656	SM00233	Pleckstrin-like
	IPR003130	677	768	SM00302	Dynamin GTPase effector
ProfileScan	IPR001849	548	654	PS50003	Pleckstrin-like
ScanRegExp	IPR001401	90	99	PS00410	Dynamin

Primer_f	CTCCAGATTGTAGTCATTTTG
Primer_r	GGTCTCCAGAGGTTTTACTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGTCTCCAGAGGTTTTACTTC
Primer_r	CTCCAGATTGTAGTCATTTTG
PCR product length	161 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles