Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07416 |
---|---|
Accession No | AB011141 |
Description | zinc finger E-box binding homeobox 2 |
Clone name | hh02356 |
Vector information | |
cDNA sequence | DNA sequence (5523 bp) Predicted protein sequence (1318 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0569
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 386 | 409 | PD000003 | Zinc finger |
IPR001356 | 757 | 803 | PD000010 | Homeobox | |
IPR007087 | 1131 | 1154 | PD000003 | Zinc finger | |
HMMPfam | IPR007087 | 315 | 338 | PF00096 | Zinc finger |
IPR007087 | 345 | 367 | PF00096 | Zinc finger | |
IPR007087 | 386 | 408 | PF00096 | Zinc finger | |
IPR007087 | 414 | 438 | PF00096 | Zinc finger | |
IPR007087 | 1103 | 1125 | PF00096 | Zinc finger | |
IPR007087 | 1131 | 1153 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 315 | 338 | SM00355 | Zinc finger |
IPR015880 | 345 | 367 | SM00355 | Zinc finger | |
IPR015880 | 386 | 408 | SM00355 | Zinc finger | |
IPR015880 | 414 | 434 | SM00355 | Zinc finger | |
IPR015880 | 685 | 705 | SM00355 | Zinc finger | |
IPR001356 | 745 | 810 | SM00389 | Homeobox | |
IPR015880 | 1103 | 1125 | SM00355 | Zinc finger | |
IPR015880 | 1131 | 1153 | SM00355 | Zinc finger | |
IPR015880 | 1159 | 1180 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 315 | 343 | PS50157 | Zinc finger |
IPR007087 | 345 | 367 | PS50157 | Zinc finger | |
IPR007087 | 386 | 413 | PS50157 | Zinc finger | |
IPR007087 | 1103 | 1130 | PS50157 | Zinc finger | |
IPR007087 | 1131 | 1158 | PS50157 | Zinc finger | |
IPR007087 | 1159 | 1187 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 317 | 338 | PS00028 | Zinc finger |
IPR007087 | 347 | 367 | PS00028 | Zinc finger | |
IPR007087 | 388 | 408 | PS00028 | Zinc finger | |
IPR007087 | 1105 | 1125 | PS00028 | Zinc finger | |
IPR007087 | 1133 | 1153 | PS00028 | Zinc finger |
RT-PCR |
---|
Primer_f | AGACGAGTCCAGCTAGTGTGC |
---|---|
Primer_r | GAATCTCGTTGTTGTGCCAGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGACGAGTCCAGCTAGTGTGC |
Primer_r | GAATCTCGTTGTTGTGCCAGG |
PCR product length | 132 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |