Gene/Protein Characteristic Table for KIAA0569
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07416
Accession No AB011141
Description zinc finger E-box binding homeobox 2
Clone name hh02356
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5523 bp)
Predicted protein sequence (1318 aa)
Source Human adult brain
Rouge ID mKIAA0569 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5523 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1318 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O60315 0 100.0 Zinc finger E-b...
Homo sapiens
XP_001158120 0 99.9 zinc finger hom...
Pan troglodytes
XP_001093325 0 99.8 zinc finger hom...
Macaca mulatta
AAI27102 0 99.9 Zinc finger E-b...
Homo sapiens
XP_001157902 0 99.9 zinc finger hom...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB107355 5.2e-06 50.0 KIAA2033
AB007872 9.9e-06 36.0 KIAA0412
AB075834 1.3e-05 38.9 KIAA1954
AB051497 1.3e-05 48.8 KIAA1710
AB040941 1.3e-05 24.6 KIAA1508
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 386 409 PD000003 Zinc finger
IPR001356 757 803 PD000010 Homeobox
IPR007087 1131 1154 PD000003 Zinc finger
HMMPfam IPR007087 315 338 PF00096 Zinc finger
IPR007087 345 367 PF00096 Zinc finger
IPR007087 386 408 PF00096 Zinc finger
IPR007087 414 438 PF00096 Zinc finger
IPR007087 1103 1125 PF00096 Zinc finger
IPR007087 1131 1153 PF00096 Zinc finger
HMMSmart IPR015880 315 338 SM00355 Zinc finger
IPR015880 345 367 SM00355 Zinc finger
IPR015880 386 408 SM00355 Zinc finger
IPR015880 414 434 SM00355 Zinc finger
IPR015880 685 705 SM00355 Zinc finger
IPR001356 745 810 SM00389 Homeobox
IPR015880 1103 1125 SM00355 Zinc finger
IPR015880 1131 1153 SM00355 Zinc finger
IPR015880 1159 1180 SM00355 Zinc finger
ProfileScan IPR007087 315 343 PS50157 Zinc finger
IPR007087 345 367 PS50157 Zinc finger
IPR007087 386 413 PS50157 Zinc finger
IPR007087 1103 1130 PS50157 Zinc finger
IPR007087 1131 1158 PS50157 Zinc finger
IPR007087 1159 1187 PS50157 Zinc finger
ScanRegExp IPR007087 317 338 PS00028 Zinc finger
IPR007087 347 367 PS00028 Zinc finger
IPR007087 388 408 PS00028 Zinc finger
IPR007087 1105 1125 PS00028 Zinc finger
IPR007087 1133 1153 PS00028 Zinc finger
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f AGACGAGTCCAGCTAGTGTGC
Primer_r GAATCTCGTTGTTGTGCCAGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name GeneBridge 4
Primer_f AGACGAGTCCAGCTAGTGTGC
Primer_r GAATCTCGTTGTTGTGCCAGG
PCR product length 132 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp