Order Kazusa clone(s) from : ![]() |
Product ID | ORK00070 |
---|---|
Accession No | AB007872 |
Description | zinc finger protein 264 |
Clone name | hg03242 |
Vector information | |
cDNA sequence | DNA sequence (6530 bp) Predicted protein sequence (720 aa) |
HaloTag ORF Clone |
FHC00070
![]() |
Flexi ORF Clone | FXC00070 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 4283 bp |
---|---|
Genome contig ID | gi42406306f_62294731 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (127608 - 127657) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 62394731 | 62422337 | 5 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 324 | 347 | PD000003 | Zinc finger |
IPR007087 | 352 | 375 | PD000003 | Zinc finger | |
IPR007087 | 380 | 403 | PD000003 | Zinc finger | |
IPR007087 | 436 | 459 | PD000003 | Zinc finger | |
IPR007087 | 464 | 487 | PD000003 | Zinc finger | |
IPR007087 | 492 | 515 | PD000003 | Zinc finger | |
IPR007087 | 520 | 543 | PD000003 | Zinc finger | |
IPR007087 | 548 | 571 | PD000003 | Zinc finger | |
IPR007087 | 576 | 599 | PD000003 | Zinc finger | |
IPR007087 | 604 | 627 | PD000003 | Zinc finger | |
IPR007087 | 632 | 655 | PD000003 | Zinc finger | |
HMMPfam | IPR001909 | 107 | 147 | PF01352 | KRAB box |
IPR007087 | 296 | 318 | PF00096 | Zinc finger | |
IPR007087 | 324 | 346 | PF00096 | Zinc finger | |
IPR007087 | 352 | 374 | PF00096 | Zinc finger | |
IPR007087 | 380 | 402 | PF00096 | Zinc finger | |
IPR007087 | 408 | 430 | PF00096 | Zinc finger | |
IPR007087 | 436 | 458 | PF00096 | Zinc finger | |
IPR007087 | 464 | 486 | PF00096 | Zinc finger | |
IPR007087 | 492 | 514 | PF00096 | Zinc finger | |
IPR007087 | 520 | 542 | PF00096 | Zinc finger | |
IPR007087 | 548 | 570 | PF00096 | Zinc finger | |
IPR007087 | 576 | 598 | PF00096 | Zinc finger | |
IPR007087 | 604 | 626 | PF00096 | Zinc finger | |
IPR007087 | 632 | 654 | PF00096 | Zinc finger | |
HMMSmart | IPR001909 | 107 | 167 | SM00349 | KRAB box |
IPR015880 | 296 | 318 | SM00355 | Zinc finger | |
IPR015880 | 324 | 346 | SM00355 | Zinc finger | |
IPR015880 | 352 | 374 | SM00355 | Zinc finger | |
IPR015880 | 380 | 402 | SM00355 | Zinc finger | |
IPR015880 | 408 | 430 | SM00355 | Zinc finger | |
IPR015880 | 436 | 458 | SM00355 | Zinc finger | |
IPR015880 | 464 | 486 | SM00355 | Zinc finger | |
IPR015880 | 492 | 514 | SM00355 | Zinc finger | |
IPR015880 | 520 | 542 | SM00355 | Zinc finger | |
IPR015880 | 548 | 570 | SM00355 | Zinc finger | |
IPR015880 | 576 | 598 | SM00355 | Zinc finger | |
IPR015880 | 604 | 626 | SM00355 | Zinc finger | |
IPR015880 | 632 | 654 | SM00355 | Zinc finger | |
ProfileScan | IPR001909 | 107 | 178 | PS50805 | KRAB box |
IPR007087 | 296 | 323 | PS50157 | Zinc finger | |
IPR007087 | 324 | 351 | PS50157 | Zinc finger | |
IPR007087 | 352 | 379 | PS50157 | Zinc finger | |
IPR007087 | 380 | 407 | PS50157 | Zinc finger | |
IPR007087 | 408 | 435 | PS50157 | Zinc finger | |
IPR007087 | 436 | 463 | PS50157 | Zinc finger | |
IPR007087 | 464 | 491 | PS50157 | Zinc finger | |
IPR007087 | 492 | 519 | PS50157 | Zinc finger | |
IPR007087 | 520 | 547 | PS50157 | Zinc finger | |
IPR007087 | 548 | 575 | PS50157 | Zinc finger | |
IPR007087 | 576 | 603 | PS50157 | Zinc finger | |
IPR007087 | 604 | 631 | PS50157 | Zinc finger | |
IPR007087 | 632 | 659 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 298 | 318 | PS00028 | Zinc finger |
IPR007087 | 326 | 346 | PS00028 | Zinc finger | |
IPR007087 | 354 | 374 | PS00028 | Zinc finger | |
IPR007087 | 382 | 402 | PS00028 | Zinc finger | |
IPR007087 | 410 | 430 | PS00028 | Zinc finger | |
IPR007087 | 438 | 458 | PS00028 | Zinc finger | |
IPR007087 | 466 | 486 | PS00028 | Zinc finger | |
IPR007087 | 494 | 514 | PS00028 | Zinc finger | |
IPR007087 | 522 | 542 | PS00028 | Zinc finger | |
IPR007087 | 550 | 570 | PS00028 | Zinc finger | |
IPR007087 | 578 | 598 | PS00028 | Zinc finger | |
IPR007087 | 606 | 626 | PS00028 | Zinc finger | |
IPR007087 | 634 | 654 | PS00028 | Zinc finger |
![]() |
---|
![]() |
Primer_f | CAGAGAGCTAGGGAATTTTAC |
---|---|
Primer_r | AAATGTTAAACTATCTGGGGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAGAGAGCTAGGGAATTTTAC |
Primer_r | AAATGTTAAACTATCTGGGGG |
PCR product length | 155 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |