Gene/Protein Characteristic Table for KIAA0412
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00070
Accession No AB007872
Description zinc finger protein 264
Clone name hg03242
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6530 bp)
Predicted protein sequence (720 aa)
Flexi ORF Clone FXC00070
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 6530 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 4283 bp
Genome contig ID gi42406306f_62294731
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
ACTCCAGCCTGGGCAACAGAGCGAGACTCCATCTC
Flanking genome sequence
(127608 - 127657)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAATTCTCTAGCTCTCTATGCCTTGTTGTATCCTCAGGA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 f 62394731 62422337 5 99.5 Perfect prediction
Features of the protein sequence
Description

Length: 720 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O43296 0 100.0 Zinc finger pro...
 Homo sapiens
AAI15412 0 99.7 ZNF264 protein ...
 Homo sapiens
NP_001018857 0 85.5 zinc finger pro...
 Homo sapiens
XP_001492137 0 86.2 similar to Zinc...
 Equus caballus
Q5CZA5 0 85.7 Zinc finger pro...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046831 1.6e-63 44.5 KIAA1611
AB075836 1.6e-63 41.9 KIAA1956
AB018341 5e-63 42.9 KIAA0798
AB075827 5.4e-62 44.3 KIAA1947
D31763 4.6e-61 40.1 KIAA0065
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 324 347 PD000003 Zinc finger
IPR007087 352 375 PD000003 Zinc finger
IPR007087 380 403 PD000003 Zinc finger
IPR007087 436 459 PD000003 Zinc finger
IPR007087 464 487 PD000003 Zinc finger
IPR007087 492 515 PD000003 Zinc finger
IPR007087 520 543 PD000003 Zinc finger
IPR007087 548 571 PD000003 Zinc finger
IPR007087 576 599 PD000003 Zinc finger
IPR007087 604 627 PD000003 Zinc finger
IPR007087 632 655 PD000003 Zinc finger
HMMPfam IPR001909 107 147 PF01352 KRAB box
IPR007087 296 318 PF00096 Zinc finger
IPR007087 324 346 PF00096 Zinc finger
IPR007087 352 374 PF00096 Zinc finger
IPR007087 380 402 PF00096 Zinc finger
IPR007087 408 430 PF00096 Zinc finger
IPR007087 436 458 PF00096 Zinc finger
IPR007087 464 486 PF00096 Zinc finger
IPR007087 492 514 PF00096 Zinc finger
IPR007087 520 542 PF00096 Zinc finger
IPR007087 548 570 PF00096 Zinc finger
IPR007087 576 598 PF00096 Zinc finger
IPR007087 604 626 PF00096 Zinc finger
IPR007087 632 654 PF00096 Zinc finger
HMMSmart IPR001909 107 167 SM00349 KRAB box
IPR015880 296 318 SM00355 Zinc finger
IPR015880 324 346 SM00355 Zinc finger
IPR015880 352 374 SM00355 Zinc finger
IPR015880 380 402 SM00355 Zinc finger
IPR015880 408 430 SM00355 Zinc finger
IPR015880 436 458 SM00355 Zinc finger
IPR015880 464 486 SM00355 Zinc finger
IPR015880 492 514 SM00355 Zinc finger
IPR015880 520 542 SM00355 Zinc finger
IPR015880 548 570 SM00355 Zinc finger
IPR015880 576 598 SM00355 Zinc finger
IPR015880 604 626 SM00355 Zinc finger
IPR015880 632 654 SM00355 Zinc finger
ProfileScan IPR001909 107 178 PS50805 KRAB box
IPR007087 296 323 PS50157 Zinc finger
IPR007087 324 351 PS50157 Zinc finger
IPR007087 352 379 PS50157 Zinc finger
IPR007087 380 407 PS50157 Zinc finger
IPR007087 408 435 PS50157 Zinc finger
IPR007087 436 463 PS50157 Zinc finger
IPR007087 464 491 PS50157 Zinc finger
IPR007087 492 519 PS50157 Zinc finger
IPR007087 520 547 PS50157 Zinc finger
IPR007087 548 575 PS50157 Zinc finger
IPR007087 576 603 PS50157 Zinc finger
IPR007087 604 631 PS50157 Zinc finger
IPR007087 632 659 PS50157 Zinc finger
ScanRegExp IPR007087 298 318 PS00028 Zinc finger
IPR007087 326 346 PS00028 Zinc finger
IPR007087 354 374 PS00028 Zinc finger
IPR007087 382 402 PS00028 Zinc finger
IPR007087 410 430 PS00028 Zinc finger
IPR007087 438 458 PS00028 Zinc finger
IPR007087 466 486 PS00028 Zinc finger
IPR007087 494 514 PS00028 Zinc finger
IPR007087 522 542 PS00028 Zinc finger
IPR007087 550 570 PS00028 Zinc finger
IPR007087 578 598 PS00028 Zinc finger
IPR007087 606 626 PS00028 Zinc finger
IPR007087 634 654 PS00028 Zinc finger
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f CAGAGAGCTAGGGAATTTTAC
Primer_r AAATGTTAAACTATCTGGGGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name GeneBridge 4
Primer_f CAGAGAGCTAGGGAATTTTAC
Primer_r AAATGTTAAACTATCTGGGGG
PCR product length 155 bp
PCR conditions 95 °C15 sec60 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp