KIAA0926

Product ID	ORK00148
Accession No	AB023143
Description	NLR family, pyrin domain containing 1, transcript variant 2
Clone name	hh02962
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5444 bp) Predicted protein sequence (1447 aa)
HaloTag ORF Clone	FHC00148
Flexi ORF Clone	FXC00148
Source	Human adult brain

Length: 5444 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	632 bp
Genome contig ID	gi51511734r_5258396
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AAAAAATGAAAATAAAGGAATAAGAAGTTACCTAC
Flanking genome sequence (99770 - 99721)	----+--------+--------+--------+--------+----* TCCATAGGCACAGCAGTCCCGACTGGCTGCTGGTTGGCTATTTTTGTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	5358166	5428523	16	100.0	Perfect prediction

Length: 1447 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAG30288	100.0	NALP1 [Homo sap...	Homo sapiens
EAW90327	99.9	NACHT, leucine ...	Homo sapiens
EAW90323	99.8	NACHT, leucine ...	Homo sapiens
AAG15254	99.4	caspase recruit...	Homo sapiens
XP_523840	97.0	death effector ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023172	1.4e-20	38.9	KIAA0955

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000767	347	362	PR00364	Disease resistance protein
	IPR000767	417	431	PR00364	Disease resistance protein
	IPR000767	823	839	PR00364	Disease resistance protein
	IPR001611	828	841	PR00019	Leucine-rich repeat
	IPR001611	939	952	PR00019	Leucine-rich repeat
HMMPfam	IPR004020	23	106	PF02758	Pyrin
	IPR007111	346	515	PF05729	NACHT nucleoside triphosphatase
	IPR001611	827	850	PF00560	Leucine-rich repeat
	IPR001611	884	907	PF00560	Leucine-rich repeat
	IPR001611	941	959	PF00560	Leucine-rich repeat
	IPR001315	1353	1436	PF00619	Caspase Recruitment
HMMSmart	IPR003590	825	852	SM00368	Leucine-rich repeat
	IPR003590	854	881	SM00368	Leucine-rich repeat
	IPR003590	882	909	SM00368	Leucine-rich repeat
	IPR003590	911	938	SM00368	Leucine-rich repeat
	IPR003590	939	966	SM00368	Leucine-rich repeat
ProfileScan	IPR004020	19	110	PS50824	Pyrin
	IPR007111	346	655	PS50837	NACHT nucleoside triphosphatase
	IPR001315	1354	1437	PS50209	Caspase Recruitment

Primer_f	ATCTCATGCCTGCAACTACTC
Primer_r	CAACCTCCACCGATGTCACTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATCTCATGCCTGCAACTACTC
Primer_r	CAACCTCCACCGATGTCACTC
PCR product length	135 (0.5k) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles