Gene/Protein Characteristic Table for KIAA0926
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00148
Accession No AB023143
Description NLR family, pyrin domain containing 1, transcript variant 2
Clone name hh02962
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5444 bp)
Predicted protein sequence (1447 aa)
Flexi ORF Clone FXC00148
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 5444 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 632 bp
Genome contig ID gi51511734r_5258396
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
AAAAAATGAAAATAAAGGAATAAGAAGTTACCTAC
Flanking genome sequence
(99770 - 99721)
----+----*----+----*----+----*----+----*----+----*
TCCATAGGCACAGCAGTCCCGACTGGCTGCTGGTTGGCTATTTTTGTGGT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 17 r 5358166 5428523 16 100.0 Perfect prediction
Features of the protein sequence
Description

Length: 1447 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAG30288 0 100.0 NALP1 [Homo sap...
Homo sapiens
EAW90327 0 99.9 NACHT, leucine ...
Homo sapiens
EAW90323 0 99.8 NACHT, leucine ...
Homo sapiens
AAG15254 0 99.4 caspase recruit...
Homo sapiens
XP_523840 0 97.0 death effector ...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB023172 1.4e-20 38.9 KIAA0955
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000767 347 362 PR00364 Disease resistance protein
IPR000767 417 431 PR00364 Disease resistance protein
IPR000767 823 839 PR00364 Disease resistance protein
IPR001611 828 841 PR00019 Leucine-rich repeat
IPR001611 939 952 PR00019 Leucine-rich repeat
HMMPfam IPR004020 23 106 PF02758 Pyrin
IPR007111 346 515 PF05729 NACHT nucleoside triphosphatase
IPR001611 827 850 PF00560 Leucine-rich repeat
IPR001611 884 907 PF00560 Leucine-rich repeat
IPR001611 941 959 PF00560 Leucine-rich repeat
IPR001315 1353 1436 PF00619 Caspase Recruitment
HMMSmart IPR003590 825 852 SM00368 Leucine-rich repeat
IPR003590 854 881 SM00368 Leucine-rich repeat
IPR003590 882 909 SM00368 Leucine-rich repeat
IPR003590 911 938 SM00368 Leucine-rich repeat
IPR003590 939 966 SM00368 Leucine-rich repeat
ProfileScan IPR004020 19 110 PS50824 Pyrin
IPR007111 346 655 PS50837 NACHT nucleoside triphosphatase
IPR001315 1354 1437 PS50209 Caspase Recruitment
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATCTCATGCCTGCAACTACTC
Primer_r CAACCTCCACCGATGTCACTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name GeneBridge 4
Primer_f ATCTCATGCCTGCAACTACTC
Primer_r CAACCTCCACCGATGTCACTC
PCR product length 135 (0.5k) bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp