KIAA1901

Product ID	ORK01183
Accession No	AB067488
Description	NIMA-related kinase 1, transcript variant 2
Clone name	hh03635
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5497 bp) Predicted protein sequence (1265 aa)
HaloTag ORF Clone	FHC01183
Flexi ORF Clone	FXC01183
Source	Human adult brain
Rouge ID	mKIAA1901 by Kazusa Mouse cDNA Project

Length: 5497 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1228 bp
Genome contig ID	gi89161207r_170451006
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- TATTTTATGATATTGCTATTAAATTTTTATTATCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTGAAGTATATCAATTGTCTTTTATTTATTATTTTACTTTTCTCAATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	170551006	170770189	34	99.8	Perfect prediction

Length: 1265 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96PY6	100.0	Serine/threonin...	Homo sapiens
EAX04788	99.6	NIMA (never in ...	Homo sapiens
XP_001153129	99.7	NIMA (never in ...	Pan troglodytes
XP_001082793	97.5	NIMA (never in ...	Macaca mulatta
XP_001915719	88.0	similar to Seri...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB082526	3.9e-22	42.3	KIAA1995
AB033104	2.4e-15	35.9	KIAA1278
AB058763	3.4e-12	30.0	KIAA1860
AB032968	7.4e-12	30.9	KIAA1142
AB018265	1.1e-11	31.0	KIAA0722

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	11	255	PD000001	Protein kinase
HMMPfam	IPR000719	11	265	PF00069	Protein kinase
HMMSmart	IPR001245	11	264	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	11	265	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	11	265	PS50011	Protein kinase
ScanRegExp	IPR000719	17	40	PS00107	Protein kinase
ScanRegExp	IPR008271	131	143	PS00108	Serine/threonine protein kinase

Primer_f	AGATTTACAAGAGCTGCAGGC
Primer_r	CTTCGTTCAGGGCACTTTCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-