KIAA0936

Product ID	ORK00689
Accession No	AB023153
Description	intestinal cell (MAK-like) kinase, transcript variant 1
Clone name	hh04647
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6014 bp) Predicted protein sequence (640 aa)
HaloTag ORF Clone	FHC00689
Flexi ORF Clone	FXC00689
Source	Human adult brain
Rouge ID	mKIAA0936 by Kazusa Mouse cDNA Project

Length: 6014 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3849 bp
Genome contig ID	gi89161210r_52874057
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- CTGGTCCAAATAAAGTTGAAGTTTAAGAAAAATTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGAGTGTTCTGTTTTTGTTTTCATGTTCTTCCATTAGTATTTTCTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	52974057	53034446	14	100.0	Perfect prediction

Length: 640 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UPZ9	1.1e-212	100.0	Serine/threonin...	Homo sapiens
BAG52026	1.5e-212	99.8	unnamed protein...	Homo sapiens
XP_001154965	1.1e-210	99.1	intestinal cell...	Pan troglodytes
AAF37278	2.8e-210	99.1	intestinal cell...	Homo sapiens
XP_538964	8.8e-203	93.1	similar to inte...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020641	1.8e-15	37.4	KIAA0834
AB020711	1.9e-11	27.5	KIAA0904
AB037782	1.1e-08	24.4	KIAA1361
AB033104	1.6e-08	25.9	KIAA1278
AB067488	3e-08	24.1	KIAA1901

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	15	283	PD000001	Protein kinase
HMMPfam	IPR000719	12	292	PF00069	Protein kinase
HMMSmart	IPR001245	12	292	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	12	292	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	12	292	PS50011	Protein kinase
ScanRegExp	IPR000719	18	42	PS00107	Protein kinase
ScanRegExp	IPR008271	129	141	PS00108	Serine/threonine protein kinase

Primer_f	GTGTCATCTTCTGGAGTTATC
Primer_r	CTGAATGGCACAAAACAATGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-