KIAA0937

Product ID	ORK00152
Accession No	AB023154
Description	deltex 4, E3 ubiquitin ligase, transcript variant 1
Clone name	hh04715
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5650 bp) Predicted protein sequence (653 aa)
HaloTag ORF Clone	FHC00152
Flexi ORF Clone	FXC00152
Source	Human adult brain

Length: 5650 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3686 bp
Genome contig ID	gi51511727f_58596541
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACAAGAACACAAAAATAAAATGCAAATACAGAGCC
Flanking genome sequence (136097 - 136146)	----+--------+--------+--------+--------+----* AGCTTTGTCACCCAAATCTGTGTCTATTTCTGATAGTCCATGGAATGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	58696541	58732636	9	99.3	Perfect prediction

Length: 653 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_508449	0	99.7	deltex 4 homolo...	Pan troglodytes
XP_001088765	0	97.1	similar to delt...	Macaca mulatta
Q9Y2E6	0	100.0	Protein deltex-...	Homo sapiens
Q6PDK8	1.2e-208	93.9	Protein deltex-...	Mus musculus
AAH58647	2.2e-208	93.7	Deltex 4 homolo...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040961	1.1e-40	46.2	KIAA1528

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004170	30	112	PF02825	WWE
	IPR004170	113	189	PF02825	WWE
	IPR001841	443	501	PF00097	Zinc finger
HMMSmart	IPR004170	39	120	SM00678	WWE
	IPR004170	122	197	SM00678	WWE
	IPR001841	443	501	SM00184	Zinc finger
ProfileScan	IPR004170	30	112	PS50918	WWE
	IPR004170	113	189	PS50918	WWE
	IPR001841	443	502	PS50089	Zinc finger

Primer_f	TCCCTGAGTCTGTAAGCAACC
Primer_r	AATGTGGTCTGTTCCTTTAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-