KIAA1008

Product ID	ORK01142
Accession No	AB023225
Description	DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease, transcript variant 2
Clone name	hh04776s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (5231 bp) Predicted protein sequence (935 aa)
HaloTag ORF Clone	FHC01142
Flexi ORF Clone	FXC01142
Source	Human adult brain
Rouge ID	mKIAA1008 by Kazusa Mouse cDNA Project
Note	We replaced hh04776, former representative clones for KIAA1008 with hh04776s1. (2002/5/10)

Length: 5231 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2351 bp
Genome contig ID	gi51511729r_72129866
PolyA signal sequence (None)	+--------+--------+----*----+---- GTTCAGCCTGGATGATGAGAGTGAGACTCCATCGC
Flanking genome sequence (99716 - 99667)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAGAAAAGAAAATTAGCCAGGTGTGGTGGCAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	r	72229582	72254064	21	99.5	Perfect prediction

Length: 935 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11273	100.0	exosome complex...	synthetic construct
AAH56143	95.0	DIS3 mitotic co...	Homo sapiens
BAF92610	94.9	DIS3 [Homo sapi...	Homo sapiens
CAH56266	94.7	hypothetical pr...	Homo sapiens
XP_001495267	90.1	DIS3 mitotic co...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075835	1.5e-48	37.2	KIAA1955
AB051556	1.4e-12	24.0	KIAA1769

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001900	444	774	PF00773	Ribonuclease II and R
ScanRegExp	IPR001900	741	765	PS01175	Ribonuclease II and R

Primer_f	CTTCCCTTGCTAATCACAGAG
Primer_r	TGGAACCTGGCACAACGTAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-