KIAA0942

Product ID	ORK06506
Accession No	AB023159
Description	pleckstrin and Sec7 domain containing 3
Clone name	hh04979s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hh04979s1 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (6670 bp) Predicted protein sequence (537 aa)
Source	Human adult brain
Rouge ID	mKIAA0942 by Kazusa Mouse cDNA Project
Note	We replaced hh04979, former representative clones for KIAA0942 with hh04979s1. (2002/5/10)

Length: 6670 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	5038 bp
Genome contig ID	gi51511724r_18332500
PolyA signal sequence (AATACA,-7)	+--------+--------+----*----+---- CAAGGGCATAGCTCCCTGTAATTTGGGAAATACAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGAAAAGAAAAAAAAAAAAAAAGGCAGCCTGTGCAGTCTTAGTAACTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	18432500	18710666	13	99.2	Perfect prediction

Length: 537 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG72691	4.6e-210	100.0	pleckstrin and ...	synthetic construct
XP_001147696	2e-209	99.6	ADP-ribosylatio...	Pan troglodytes
XP_001147547	8.5e-204	96.6	similar to guan...	Pan troglodytes
AAH75044	9.1e-204	96.9	PSD3 protein [H...	Homo sapiens
EAW63782	1.5e-203	96.9	pleckstrin and ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095931	5.6e-96	59.0	KIAA2011
D87435	2.2e-12	26.1	KIAA0248
AB018306	1.7e-11	30.8	KIAA0763
AB029033	3.3e-11	34.2	KIAA1110
AB011094	1.8e-10	30.5	KIAA0522

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001605	277	296	PR00683	Spectrin/pleckstrin-like
	IPR001605	342	359	PR00683	Spectrin/pleckstrin-like
	IPR001605	362	380	PR00683	Spectrin/pleckstrin-like
HMMPfam	IPR000904	40	225	PF01369	SEC7-like
HMMPfam	IPR001849	275	387	PF00169	Pleckstrin-like
HMMSmart	IPR000904	38	225	SM00222	SEC7-like
HMMSmart	IPR001849	275	389	SM00233	Pleckstrin-like
ProfileScan	IPR000904	38	223	PS50190	SEC7-like
ProfileScan	IPR001849	274	387	PS50003	Pleckstrin-like

Primer_f	ATGAAAAGCAAGTACAACCTC
Primer_r	CACTGCAAAAGATTCACAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-