KIAA1142

Product ID	ORK00749
Accession No	AB032968
Description	p21 protein (Cdc42/Rac)-activated kinase 4, transcript variant 5
Clone name	hh05864
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5742 bp) Predicted protein sequence (467 aa)
HaloTag ORF Clone	FHC00749
Flexi ORF Clone	FXC00749
Source	Human adult brain
Rouge ID	mKIAA1142 by Kazusa Mouse cDNA Project

Length: 5742 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4244 bp
Genome contig ID	gi42406306f_44208314
PolyA signal sequence (None)	+--------+--------+----*----+---- GCACTCCAGCCTGGGTGACAGAGTGAGATTCCGTC
Flanking genome sequence (156984 - 157033)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGACAAAAAACAACAGGTACGGTGGCTTACACCTGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	44308314	44365296	9	99.2	Perfect prediction

Length: 467 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAD38914	9.7e-126	100.0	hypothetical pr...	Homo sapiens
XP_867241	5.7e-121	95.9	similar to p21-...	Canis lupus fam...
EAW56862	4.7e-108	89.1	p21(CDKN1A)-act...	Homo sapiens
AAH34511	3.5e-105	87.4	PAK4 protein [H...	Homo sapiens
BAG56999	1.1e-104	95.4	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033090	9e-43	65.6	KIAA1264
D86959	1.3e-12	33.6	KIAA0204
AB020688	3.9e-12	35.9	KIAA0881
AB037782	7e-12	37.0	KIAA1361
AB011123	4.3e-11	38.6	KIAA0551

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	203	447	PD000001	Protein kinase
HMMPfam	IPR000095	39	96	PF00786	PAK-box/P21-Rho-binding
HMMPfam	IPR000719	197	448	PF00069	Protein kinase
HMMSmart	IPR000095	40	75	SM00285	PAK-box/P21-Rho-binding
	IPR001245	197	448	SM00219	Tyrosine protein kinase
	IPR002290	197	448	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000095	40	53	PS50108	PAK-box/P21-Rho-binding
ProfileScan	IPR000719	197	448	PS50011	Protein kinase
ScanRegExp	IPR000719	203	227	PS00107	Protein kinase

Primer_f	AGGTCATAGCAGCCAGTAAGC
Primer_r	TACTCACCAAACGCGCTCAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-