Gene/Protein Characteristic Table for KIAA0754
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05620
Accession No AB018297
Description KIAA0754
Clone name hh06485
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5460 bp)
Predicted protein sequence (1174 aa)
Source Human adult brain
Rouge ID mKIAA0754 by Kazusa Mouse cDNA Project
Note We replaced hk04470, former representative clones for KIAA0754 with hh06485. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 5460 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1933 bp
Genome contig ID gi89161185f_39549282
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAGCCTAGGCAACATAGTAAGACCCCATCTCTGAG
Flanking genome sequence
(105461 - 105510)
----+----*----+----*----+----*----+----*----+----*
AAAATAAAAAGAAAAAAAAAAAAACAGAATATCTCCAGTATAAAGCTTAT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 1 f 39649282 39654741 1 99.0 Perfect prediction
Features of the protein sequence
Description

Length: 1174 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_055853 0 100.0 hypothetical pr...
Homo sapiens
XP_001170899 0 93.2 hypothetical pr...
Pan troglodytes
BAC87042 1.7e-207 98.7 unnamed protein...
Homo sapiens
AAW51128 7.8e-24 31.2 minus agglutini...
Chlamydomonas i...
AAX33674 2.5e-22 32.1 plus agglutinin...
Chlamydomonas i...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB051468 0.00023 22.2 KIAA1681
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATAATCTGGCCTTGCTGAGTG
Primer_r TACAGGCTATTGGGATCTCGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f ATAATCTGGCCTTGCTGAGTG
Primer_r TACAGGCTATTGGGATCTCGG
PCR product length 171 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp