KIAA0754

Product ID	ORK05620
Accession No	AB018297
Description	KIAA0754
Clone name	hh06485
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5460 bp) Predicted protein sequence (1174 aa)
Source	Human adult brain
Rouge ID	mKIAA0754 by Kazusa Mouse cDNA Project
Note	We replaced hk04470, former representative clones for KIAA0754 with hh06485. (2002/5/10)

Length: 5460 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1933 bp
Genome contig ID	gi89161185f_39549282
PolyA signal sequence (None)	+--------+--------+----*----+---- CAGCCTAGGCAACATAGTAAGACCCCATCTCTGAG
Flanking genome sequence (105461 - 105510)	----+--------+--------+--------+--------+----* AAAATAAAAAGAAAAAAAAAAAAACAGAATATCTCCAGTATAAAGCTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	39649282	39654741	1	99.0	Perfect prediction

Length: 1174 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_055853	0	100.0	hypothetical pr...	Homo sapiens
XP_001170899	0	93.2	hypothetical pr...	Pan troglodytes
BAC87042	1.7e-207	98.7	unnamed protein...	Homo sapiens
AAW51128	7.8e-24	31.2	minus agglutini...	Chlamydomonas i...
AAX33674	2.5e-22	32.1	plus agglutinin...	Chlamydomonas i...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051468	0.00023	22.2	KIAA1681

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	ATAATCTGGCCTTGCTGAGTG
Primer_r	TACAGGCTATTGGGATCTCGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATAATCTGGCCTTGCTGAGTG
Primer_r	TACAGGCTATTGGGATCTCGG
PCR product length	171 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles