KIAA1442

Gene/Protein Characteristic Table for KIAA1442

Order Kazusa clone(s) from :

Product ID	ORK00838
Accession No	AB037863
Description	early B-cell factor 4
Clone name	hh10127b
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2782 bp) Predicted protein sequence (627 aa)
HaloTag ORF Clone	FHC00838
Flexi ORF Clone	FXC00838
Source	Human adult brain

Length: 2782 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	897 bp
Genome contig ID	gi51511747f_2521689
PolyA signal sequence (None)	+--------+--------+----*----+---- AGGTGGTGCCCGCCCGGCCTCTCACCTGCCTCCTT
Flanking genome sequence (167060 - 167109)	----+--------+--------+--------+--------+----* GGTGTGAGTTTGCTTTTCTTAGCAGTTCAGCAGCTCTAGGGGAGGCTCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	2621524	2688747	18	99.6	Perfect prediction

Features of the protein sequence

Description

Length: 627 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX10577	1.4e-206	99.5	hCG39626, isofo...	Homo sapiens
CAM20111	6.9e-184	90.3	early B-cell fa...	Mus musculus
BAG10068	9.2e-178	100.0	early B-cell fa...	synthetic construct
XP_001713773	1.8e-177	99.8	early B-cell fa...	Homo sapiens
NP_001103984	1.6e-166	95.2	early B-cell fa...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002909	339	421	PF01833	Cell surface receptor IPT/TIG
HMMSmart	IPR002909	338	422	SM00429	Cell surface receptor IPT/TIG
ScanRegExp	IPR003523	245	254	PS01345	Transcription factor COE

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GTATAACAATGGACTGCGGAC
Primer_r	CCGCATTCTTCAGGCAGTTCT
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 20

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CACTTCCTTTGAGACCTGCAC
Primer_r	GGAAGACCCCAAATACAGGAG
PCR product length	115 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp