KIAA1056

Product ID	ORK00725
Accession No	AB028979
Description	zinc finger homeobox 2
Clone name	hh11792
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5428 bp) Predicted protein sequence (870 aa)
HaloTag ORF Clone	FHC00725
Flexi ORF Clone	FXC00725
Source	Human adult brain
Rouge ID	mKIAA1056 by Kazusa Mouse cDNA Project

Length: 5428 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2483 bp
Genome contig ID	gi51511730r_22967258
PolyA signal sequence (None)	+--------+--------+----*----+---- CACTCCGGCCTGGGTGACAGAGCCAGACTCCATCT
Flanking genome sequence (99717 - 99668)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAGGAGTGGGGGCGGGCCAGTGCTGCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	23066975	23090698	4	99.2	Perfect prediction

Length: 870 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPU6	100.0	Zinc finger pro...	Homo sapiens
EAW66144	99.7	zinc finger hom...	Homo sapiens
XP_001715032	99.8	similar to zinc...	Homo sapiens
EAW66142	99.5	zinc finger hom...	Homo sapiens
EAW66145	99.8	zinc finger hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	461	484	PF00096	Zinc finger
HMMPfam	IPR007087	516	540	PF00096	Zinc finger
HMMSmart	IPR015880	245	267	SM00355	Zinc finger
	IPR015880	461	484	SM00355	Zinc finger
	IPR015880	516	540	SM00355	Zinc finger
	IPR015880	577	601	SM00355	Zinc finger
	IPR015880	766	790	SM00355	Zinc finger
	IPR015880	829	853	SM00355	Zinc finger
ScanRegExp	IPR007087	247	267	PS00028	Zinc finger
ScanRegExp	IPR007087	463	484	PS00028	Zinc finger

Primer_f	TCACAGAGAAGACACGACAGG
Primer_r	CCTCAACTCTCCAGCTAACAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCACAGAGAAGACACGACAGG
Primer_r	CCTCAACTCTCCAGCTAACAG
PCR product length	101 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles