KIAA1289

Product ID	ORK04273
Accession No	AB033115
Description	baculoviral IAP repeat containing 6
Clone name	hh15326s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (9078 bp) Predicted protein sequence (2793 aa)
Source	Human adult brain
Rouge ID	mKIAA1289 by Kazusa Mouse cDNA Project
Note	We replaced hh15326, former representative clones for KIAA1289 with hh15326s2. (2002/5/10)

Length: 9078 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	690 bp
Genome contig ID	gi89161199f_32448025
PolyA signal sequence (AATAAA,-32)	+--------+--------+----*----+---- AAAAATAAATGAACATGATTTTATTCTATGCCAAC
Flanking genome sequence (249143 - 249192)	----+--------+--------+--------+--------+----* ATTTGGGCCTCTGAATGTATCTGTTATTTGAATTTAAGTATTTGAAAAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	32548025	32697166	45	99.9	Perfect prediction

Length: 2793 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX00447	99.9	baculoviral IAP...	Homo sapiens
NP_057336	99.9	baculoviral IAP...	Homo sapiens
Q9NR09	99.9	Baculoviral IAP...	Homo sapiens
EAX00445	99.7	baculoviral IAP...	Homo sapiens
EAX00443	99.7	baculoviral IAP...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051521	2.7e-22	32.0	KIAA1734

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000608	2558	2645	PD000461	Ubiquitin-conjugating enzyme
HMMPfam	IPR000608	2513	2671	PF00179	Ubiquitin-conjugating enzyme
HMMSmart	IPR000608	2512	2676	SM00212	Ubiquitin-conjugating enzyme
ProfileScan	IPR000608	2512	2640	PS50127	Ubiquitin-conjugating enzyme

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	272	VLFLLSMDFTCHADLLLFVCKVL	294	PRIMARY	23

Primer_f	TCATCCATACAAGTGCAAGTC
Primer_r	CTGAAGACCTCCTACATACAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGGGCTCACTGCTTTTGGTAC
Primer_r	ACTTGCCATCATTCCTTCTAG
PCR product length	154(1.6k) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles