KIAA0387

Product ID	ORK00525
Accession No	AB002385
Description	protein tyrosine phosphatase, receptor type, N polypeptide 2
Clone name	hj00020s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4944 bp) Predicted protein sequence (1042 aa)
HaloTag ORF Clone	FHC00525
Flexi ORF Clone	FXC00525
Source	Human adult brain
Rouge ID	mKIAA0387 by Kazusa Mouse cDNA Project
Note	We replaced hj00020, former representative clones for KIAA0387 with hj00020s1. (2002/5/10)

Length: 4944 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1657 bp
Genome contig ID	gi89161213r_156924512
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TATTTAATTGTGTCATATTAAACTTCTGATTTCAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCAGGTGGTCTTTATTTGGGGAGGAGGAACAATTGTTTCCATCCGTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	157024512	158027229	22	99.4	Internal No-hit

Length: 1042 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09726	100.0	protein tyrosin...	synthetic construct
AAC50742	99.9	phogrin [Homo s...	Homo sapiens
Q92932	99.8	Receptor-type t...	Homo sapiens
CAA69880	99.5	Islet Cell Auto...	Homo sapiens
NP_570857	99.8	protein tyrosin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB006621	4.6e-20	32.0	KIAA0283
AB040904	3.5e-07	23.8	KIAA1471

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000242	826	833	PR00700	Protein-tyrosine phosphatase
	IPR000242	843	863	PR00700	Protein-tyrosine phosphatase
	IPR000242	928	945	PR00700	Protein-tyrosine phosphatase
	IPR000242	967	985	PR00700	Protein-tyrosine phosphatase
	IPR000242	999	1014	PR00700	Protein-tyrosine phosphatase
	IPR000242	1015	1025	PR00700	Protein-tyrosine phosphatase
HMMPfam	IPR000242	797	1031	PF00102	Protein-tyrosine phosphatase
HMMSmart	IPR000242	771	1034	SM00194	Protein-tyrosine phosphatase
HMMSmart	IPR003595	929	1031	SM00404	Protein-tyrosine phosphatase
ProfileScan	IPR000242	772	1032	PS50055	Protein-tyrosine phosphatase
ProfileScan	IPR000387	951	1023	PS50056	Protein-tyrosine phosphatase
ScanRegExp	IPR000387	970	982	PS00383	Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	643	IALTLVSLACILGVLLASGLIYC	665	PRIMARY	23

Primer_f	CTAAGATGGAGGAATGCTGTG
Primer_r	CATTTGAGTATCCGATTCGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTAAGATGGAGGAATGCTGTG
Primer_r	CATTTGAGTATCCGATTCGCC
PCR product length	184 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles