Order Kazusa clone(s) from : ![]() |
Product ID | ORK00525 |
---|---|
Accession No | AB002385 |
Description | protein tyrosine phosphatase, receptor type, N polypeptide 2 |
Clone name | hj00020s1 |
Vector information | |
cDNA sequence | DNA sequence (4944 bp) Predicted protein sequence (1042 aa) |
HaloTag ORF Clone |
FHC00525
![]() |
Flexi ORF Clone | FXC00525 |
Source | Human adult brain |
Rouge ID |
mKIAA0387
by Kazusa Mouse cDNA Project
|
Note | We replaced hj00020, former representative clones for KIAA0387 with hj00020s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1657 bp |
---|---|
Genome contig ID | gi89161213r_156924512 |
PolyA signal sequence (ATTAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | r | 157024512 | 158027229 | 22 | 99.4 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000242 | 826 | 833 | PR00700 | Protein-tyrosine phosphatase |
IPR000242 | 843 | 863 | PR00700 | Protein-tyrosine phosphatase | |
IPR000242 | 928 | 945 | PR00700 | Protein-tyrosine phosphatase | |
IPR000242 | 967 | 985 | PR00700 | Protein-tyrosine phosphatase | |
IPR000242 | 999 | 1014 | PR00700 | Protein-tyrosine phosphatase | |
IPR000242 | 1015 | 1025 | PR00700 | Protein-tyrosine phosphatase | |
HMMPfam | IPR000242 | 797 | 1031 | PF00102 | Protein-tyrosine phosphatase |
HMMSmart | IPR000242 | 771 | 1034 | SM00194 | Protein-tyrosine phosphatase |
IPR003595 | 929 | 1031 | SM00404 | Protein-tyrosine phosphatase | |
ProfileScan | IPR000242 | 772 | 1032 | PS50055 | Protein-tyrosine phosphatase |
IPR000387 | 951 | 1023 | PS50056 | Protein-tyrosine phosphatase | |
ScanRegExp | IPR000387 | 970 | 982 | PS00383 | Protein-tyrosine phosphatase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 643 | IALTLVSLACILGVLLASGLIYC | 665 | PRIMARY | 23 |
---|
![]() |
---|
Primer_f | CTAAGATGGAGGAATGCTGTG |
---|---|
Primer_r | CATTTGAGTATCCGATTCGCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTAAGATGGAGGAATGCTGTG |
Primer_r | CATTTGAGTATCCGATTCGCC |
PCR product length | 184 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |