Gene/Protein Characteristic Table for KIAA0388
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00526
Accession No AB002386
Description enhancer of zeste 1 polycomb repressive complex 2 subunit
Clone name hj00039
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4606 bp)
Predicted protein sequence (751 aa)
Flexi ORF Clone FXC00526
Source Human adult brain
Rouge ID mKIAA0388 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4606 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Features of the protein sequence
Description

Length: 751 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG58503 0 99.9 unnamed protein...
Homo sapiens
Q92800 0 100.0 Histone-lysine ...
Homo sapiens
XP_001111476 0 99.7 similar to enha...
Macaca mulatta
AAC50778 0 99.9 enhancer of zes...
Homo sapiens
Q5RDS6 0 99.7 Histone-lysine ...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB029013 1.4e-11 32.5 KIAA1090
AB028999 6.6e-11 41.9 KIAA1076
AB051519 3.6e-10 31.6 KIAA1732
AB002337 6.4e-10 39.5 KIAA0339
AB002302 2.1e-09 43.6 KIAA0304
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001214 611 738 PF00856 SET
HMMSmart IPR001005 139 267 SM00717 SANT
IPR001005 434 482 SM00717 SANT
IPR001214 617 738 SM00317 SET
ProfileScan IPR001214 616 736 PS50280 SET
ScanRegExp IPR001719 450 458 PS00729 AP endonuclease
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TAAGAGGTCACAAGCCACAGG
Primer_r CCAGTTTCCCATCCTTTGTCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name GeneBridge 4
Primer_f TAAGAGGTCACAAGCCACAGG
Primer_r CCAGTTTCCCATCCTTTGTCC
PCR product length 178 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp