KIAA0573

Product ID	ORK00564
Accession No	AB011145
Description	endoplasmic reticulum protein 44
Clone name	hj00186
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4796 bp) Predicted protein sequence (451 aa)
HaloTag ORF Clone	FHC00564
Flexi ORF Clone	FXC00564
Source	Human adult brain
Rouge ID	mKIAA0573 by Kazusa Mouse cDNA Project

Length: 4796 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3439 bp
Genome contig ID	gi89161216r_101681282
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- AAAATAAAATGACATGAAATTGCAAAAATGAAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GTAAAAAAAAAAAAATTGTTGTCACCTTAAATGATTTCAAGGTTGTTAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	101781282	101901079	12	99.3	Perfect prediction

Length: 451 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9BS26	3.3e-165	100.0	Thioredoxin dom...	Homo sapiens
AAQ89407	1.4e-164	99.8	TXNDC4 [Homo sa...	Homo sapiens
BAE91584	7.1e-164	99.3	unnamed protein...	Macaca fascicularis
BAE88644	1.1e-163	99.0	unnamed protein...	Macaca fascicularis
EDL02341	1e-159	87.5	thioredoxin dom...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058733	0.00012	21.2	KIAA1830

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006662	94	102	PR00421	Thioredoxin-related
	IPR006662	102	111	PR00421	Thioredoxin-related
	IPR006662	148	159	PR00421	Thioredoxin-related
HMMPfam	IPR013766	75	184	PF00085	Thioredoxin domain
ScanRegExp	IPR000886	448	451	PS00014	Endoplasmic reticulum targeting sequence

Primer_f	TGGGCATCTAAGGCATCTCAG
Primer_r	TTTCACTCTCCTCTCTGTAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGGGCATCTAAGGCATCTCAG
Primer_r	TTTCACTCTCCTCTCTGTAGC
PCR product length	108 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles