Order Kazusa clone(s) from : ![]() |
Product ID | ORK00564 |
---|---|
Accession No | AB011145 |
Description | endoplasmic reticulum protein 44 |
Clone name | hj00186 |
Vector information | |
cDNA sequence | DNA sequence (4796 bp) Predicted protein sequence (451 aa) |
Flexi ORF Clone | FXC00564 |
Source | Human adult brain |
Rouge ID |
mKIAA0573
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3439 bp |
---|---|
Genome contig ID | gi89161216r_101681282 |
PolyA signal sequence (AATAAA,-33) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | r | 101781282 | 101901079 | 12 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR006662 | 94 | 102 | PR00421 | Thioredoxin-related |
IPR006662 | 102 | 111 | PR00421 | Thioredoxin-related | |
IPR006662 | 148 | 159 | PR00421 | Thioredoxin-related | |
HMMPfam | IPR013766 | 75 | 184 | PF00085 | Thioredoxin domain |
ScanRegExp | IPR000886 | 448 | 451 | PS00014 | Endoplasmic reticulum targeting sequence |
![]() |
---|
Primer_f | TGGGCATCTAAGGCATCTCAG |
---|---|
Primer_r | TTTCACTCTCCTCTCTGTAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGGGCATCTAAGGCATCTCAG |
Primer_r | TTTCACTCTCCTCTCTGTAGC |
PCR product length | 108 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |