Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01095 |
---|---|
Accession No | AB011149 |
Description | DEAH (Asp-Glu-Ala-His) box polypeptide 16, transcript variant 1 |
Clone name | hj00291 |
Vector information | |
cDNA sequence | DNA sequence (5134 bp) Predicted protein sequence (1043 aa) |
HaloTag ORF Clone |
FHC01095
|
Flexi ORF Clone | FXC01095 |
Source | Human adult brain |
Rouge ID |
mKIAA0577
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001650 | 638 | 732 | PF00271 | DNA/RNA helicase |
IPR007502 | 793 | 884 | PF04408 | Helicase-associated region | |
IPR011709 | 918 | 1017 | PF07717 | Domain of unknown function DUF1605 | |
HMMSmart | IPR014001 | 399 | 584 | SM00487 | DEAD-like helicases |
IPR001650 | 635 | 732 | SM00490 | DNA/RNA helicase | |
ProfileScan | IPR014021 | 411 | 575 | PS51192 | Helicase |
IPR001650 | 600 | 773 | PS51194 | DNA/RNA helicase | |
ScanRegExp | IPR002464 | 517 | 526 | PS00690 | DNA/RNA helicase |
RT-PCR |
---|
Primer_f | CTGCTCTACCACGAACTTGTC |
---|---|
Primer_r | GTCCTTCTCTTACCCTAGCTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTGCTCTACCACGAACTTGTC |
Primer_r | GTCCTTCTCTTACCCTAGCTC |
PCR product length | 186 (1.5k) bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |