Gene/Protein Characteristic Table for KIAA0577
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01095
Accession No AB011149
Description DEAH (Asp-Glu-Ala-His) box polypeptide 16, transcript variant 1
Clone name hj00291
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5134 bp)
Predicted protein sequence (1043 aa)
Flexi ORF Clone FXC01095
Source Human adult brain
Rouge ID mKIAA0577 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5134 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1043 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O60231 0 100.0 Putative pre-mR...
Homo sapiens
CAI41883 0 99.9 DEAH (Asp-Glu-A...
Homo sapiens
AAH08825 0 99.9 DEAH (Asp-Glu-A...
Homo sapiens
ABM86832 0 99.8 DEAH (Asp-Glu-A...
synthetic construct
Q7YR39 0 99.6 Putative pre-mR...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D86977 2.7e-66 40.7 KIAA0224
AB040921 2e-15 32.4 KIAA1488
D50924 2.2e-14 31.9 KIAA0134
AB020697 3.3e-11 29.1 KIAA0890
AB040950 3.4e-10 32.6 KIAA1517
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001650 638 732 PF00271 DNA/RNA helicase
IPR007502 793 884 PF04408 Helicase-associated region
IPR011709 918 1017 PF07717 Domain of unknown function DUF1605
HMMSmart IPR014001 399 584 SM00487 DEAD-like helicases
IPR001650 635 732 SM00490 DNA/RNA helicase
ProfileScan IPR014021 411 575 PS51192 Helicase
IPR001650 600 773 PS51194 DNA/RNA helicase
ScanRegExp IPR002464 517 526 PS00690 DNA/RNA helicase
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CTGCTCTACCACGAACTTGTC
Primer_r GTCCTTCTCTTACCCTAGCTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 6
Experimental conditions
Panel name GeneBridge 4
Primer_f CTGCTCTACCACGAACTTGTC
Primer_r GTCCTTCTCTTACCCTAGCTC
PCR product length 186 (1.5k) bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp