Gene/Protein Characteristic Table for KIAA0438
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01596
Accession No AB007898
Description praja ring finger 2, E3 ubiquitin protein ligase
Clone name hj00450
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4765 bp)
Predicted protein sequence (726 aa)
Flexi ORF Clone FXC01596
Source Human adult brain
Rouge ID mKIAA0438 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4765 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 726 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O43164 0 100.0 E3 ubiquitin-pr...
Homo sapiens
AAH30826 0 99.9 Praja 2, RING-H...
Homo sapiens
EAW49050 0 99.9 praja 2, RING-H...
Homo sapiens
XP_001140363 0 99.0 praja 2, RING-H...
Pan troglodytes
CAH92828 0 98.3 hypothetical pr...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB058713 0.00012 36.0 KIAA1810
AB033040 0.0003 31.4 KIAA1214
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001841 652 692 PF00097 Zinc finger
HMMSmart IPR001841 652 692 SM00184 Zinc finger
ProfileScan IPR001841 652 693 PS50089 Zinc finger
ScanRegExp IPR002052 392 398 PS00092 N-6 Adenine-specific DNA methylase
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CGGAATCTTCTGCGGCTTGTC
Primer_r TGTCTGATACCCTCCTGCTGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 5
Experimental conditions
Panel name GeneBridge 4
Primer_f CGGAATCTTCTGCGGCTTGTC
Primer_r TGTCTGATACCCTCCTGCTGG
PCR product length 179 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp