Gene/Protein Characteristic Table for KIAA0594
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06903
Accession No AB011166
Description structural maintenance of chromosomes 5
Clone name hj02896s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5906 bp)
Predicted protein sequence (1120 aa)
Source Human adult brain
Rouge ID mKIAA0594 by Kazusa Mouse cDNA Project
Note We replaced hj02896, former representative clones for KIAA0594 with hj02896s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 5906 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2542 bp
Genome contig ID gi89161216f_71963757
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TGCTTTGTTGGTAATAAATCAATATTTTTATATTC
Flanking genome sequence
(195854 - 195903)
----+----*----+----*----+----*----+----*----+----*
TTTTGGTGTATGTTATTTTAAGTGAGAACTATTTTTTATACTCTGAACCT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 9 f 72063757 72159609 25 99.5 Perfect prediction
Features of the protein sequence
Description

Length: 1120 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_520066 0 99.5 SMC5 protein [P...
Pan troglodytes
AAH38225 0 100.0 Structural main...
Homo sapiens
Q8IY18 0 99.9 Structural main...
Homo sapiens
CAC39247 0 99.9 SMC5 protein [H...
Homo sapiens
Q8CG46 0 89.6 Structural main...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB018346 0.00023 20.9 KIAA0803
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003395 71 1099 PF02463 SMC protein
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f ATACCCGCAAAATGATAGAGG
Primer_r ACAATATGATCGTCCACACTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 9
Experimental conditions
Panel name GeneBridge 4
Primer_f AAGTCCTAGTTTCTCCCAATG
Primer_r CTGCTACCATTTTTGAACCCC
PCR product length 238 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp