|
Order Kazusa clone(s) from : |
| Product ID | ORK00583 |
|---|---|
| Accession No | AB014536 |
| Description | copine III |
| Clone name | hj03289 |
| Vector information | |
| cDNA sequence | DNA sequence (4737 bp) Predicted protein sequence (540 aa) |
|
HaloTag ORF Clone |
FHC00583
|
| Flexi ORF Clone | FXC00583 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0636
by Kazusa Mouse cDNA Project
|
Length: 4737 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Length: 540 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| FPrintScan | IPR000008 | 26 | 38 | PR00360 | C2 calcium-dependent membrane targeting |
| IPR000008 | 56 | 69 | PR00360 | C2 calcium-dependent membrane targeting | |
| IPR000008 | 78 | 86 | PR00360 | C2 calcium-dependent membrane targeting | |
| HMMPfam | IPR000008 | 12 | 102 | PF00168 | C2 calcium-dependent membrane targeting |
| IPR000008 | 143 | 233 | PF00168 | C2 calcium-dependent membrane targeting | |
| IPR010734 | 313 | 460 | PF07002 | Copine | |
| HMMSmart | IPR000008 | 10 | 117 | SM00239 | C2 calcium-dependent membrane targeting |
| IPR000008 | 142 | 248 | SM00239 | C2 calcium-dependent membrane targeting | |
| IPR002035 | 292 | 494 | SM00327 | von Willebrand factor | |
| ProfileScan | IPR000008 | 1 | 102 | PS50004 | C2 calcium-dependent membrane targeting |
| IPR000008 | 141 | 233 | PS50004 | C2 calcium-dependent membrane targeting |
RT-PCR
|
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | TTCCCTGTTGTGCCACCATTC |
|---|---|
| Primer_r | TTACATCTATCCTGGGCACCG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 8
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | TTCCCTGTTGTGCCACCATTC |
| Primer_r | TTACATCTATCCTGGGCACCG |
| PCR product length | 145 bp |
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |