KIAA0638

Product ID	ORK00584
Accession No	AB014538
Description	pleckstrin homology-like domain, family B, member 1, transcript variant 1
Clone name	hj03347s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5449 bp) Predicted protein sequence (1384 aa)
HaloTag ORF Clone	FHC00584
Flexi ORF Clone	FXC00584
Source	Human adult brain
Rouge ID	mKIAA0638 by Kazusa Mouse cDNA Project
Note	We replaced hj03347, former representative clones for KIAA0638 with hj03347s1. (2002/5/10)

Length: 5449 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1208 bp
Genome contig ID	gi51511727f_117883551
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CAGCAGAACAATAAAGCCTTTGGACTACGGAAGTG
Flanking genome sequence (150402 - 150451)	----+--------+--------+--------+--------+----* AGTGGAAGGCCGGTGTGGGGCTTGGCGCTGAGGCACTTGGGGATAGGTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	117983547	118033951	23	99.7	Terminal No-hit

Length: 1384 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q86UU1	100.0	Pleckstrin homo...	Homo sapiens
XP_001162204	99.7	pleckstrin homo...	Pan troglodytes
EAW67404	99.3	pleckstrin homo...	Homo sapiens
XP_546499	95.7	similar to plec...	Canis lupus fam...
XP_001162611	98.9	pleckstrin homo...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000253	71	132	PF00498	Forkhead-associated
HMMPfam	IPR001849	1264	1377	PF00169	Pleckstrin-like
HMMSmart	IPR001849	1264	1379	SM00233	Pleckstrin-like
ProfileScan	IPR001849	1263	1377	PS50003	Pleckstrin-like

Primer_f	TTAGAGCCAGAAGGGATGAAG
Primer_r	ACAGAACTCCAACCATAACCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTAGAGCCAGAAGGGATGAAG
Primer_r	ACAGAACTCCAACCATAACCC
PCR product length	97 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles