KIAA0647

Product ID	ORK01600
Accession No	AB014547
Description	myotubularin related protein 4
Clone name	hj03819s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-791) was subcloned upstream of the cDNA (792-5719). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGGG CCGCGGGAAT TCGAT-5' end of cDNA.
cDNA sequence	DNA sequence (5719 bp) Predicted protein sequence (1195 aa)
HaloTag ORF Clone	FHC01600
Flexi ORF Clone	FXC01600
Source	Human adult brain
Rouge ID	mKIAA0647 by Kazusa Mouse cDNA Project
Note	We replaced hj03819, former representative clones for KIAA0647 with hj03819s1. (2002/5/10)

Length: 5719 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2131 bp
Genome contig ID	gi51511734r_53821892
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ATACAGTTTAAATAAAATCTCTATATTAGTGCTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTGTTGGGTCGTTTTATTTTCATTTCTAAAAAAACTTAATATTCACTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	53921892	53945303	17	99.5	Perfect prediction

Length: 1195 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW94454	99.9	myotubularin re...	Homo sapiens
AAH35609	99.8	Myotubularin re...	Homo sapiens
XP_511909	99.5	myotubularin re...	Pan troglodytes
XP_001500659	94.0	similar to myot...	Equus caballus
XP_537692	93.7	similar to myot...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002369	4.5e-145	49.6	KIAA0371
AB028996	1.3e-31	34.3	KIAA1073
AB051469	1.9e-09	32.2	KIAA1682
AB040970	9.8e-06	29.7	KIAA1537
AB002303	1e-05	36.2	KIAA0305

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010569	183	341	PF06602	Myotubularin-related
HMMPfam	IPR000306	1109	1175	PF01363	Zinc finger
HMMSmart	IPR000306	1106	1175	SM00064	Zinc finger
ProfileScan	IPR000387	376	420	PS50056	Protein-tyrosine phosphatase
ProfileScan	IPR000306	1114	1174	PS50178	Zinc finger
ScanRegExp	IPR000387	405	417	PS00383	Protein-tyrosine phosphatase

Primer_f	TATCTGTCTACTTAGCGTGGC
Primer_r	GTCACTTACACCCACAACAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TATCTGTCTACTTAGCGTGGC
Primer_r	GTCACTTACACCCACAACAGC
PCR product length	141 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles