Order Kazusa clone(s) from : ![]() |
Product ID | ORK01600 |
---|---|
Accession No | AB014547 |
Description | myotubularin related protein 4 |
Clone name | hj03819s1 |
Vector information | |
cDNA sequence | DNA sequence (5719 bp) Predicted protein sequence (1195 aa) |
HaloTag ORF Clone |
FHC01600
![]() |
Flexi ORF Clone | FXC01600 |
Source | Human adult brain |
Rouge ID |
mKIAA0647
by Kazusa Mouse cDNA Project
|
Note | We replaced hj03819, former representative clones for KIAA0647 with hj03819s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2131 bp |
---|---|
Genome contig ID | gi51511734r_53821892 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 53921892 | 53945303 | 17 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR010569 | 183 | 341 | PF06602 | Myotubularin-related |
IPR000306 | 1109 | 1175 | PF01363 | Zinc finger | |
HMMSmart | IPR000306 | 1106 | 1175 | SM00064 | Zinc finger |
ProfileScan | IPR000387 | 376 | 420 | PS50056 | Protein-tyrosine phosphatase |
IPR000306 | 1114 | 1174 | PS50178 | Zinc finger | |
ScanRegExp | IPR000387 | 405 | 417 | PS00383 | Protein-tyrosine phosphatase |
![]() |
---|
Primer_f | TATCTGTCTACTTAGCGTGGC |
---|---|
Primer_r | GTCACTTACACCCACAACAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TATCTGTCTACTTAGCGTGGC |
Primer_r | GTCACTTACACCCACAACAGC |
PCR product length | 141 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |