Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00208 |
---|---|
Accession No | AB033091 |
Description | solute carrier family 39 (zinc transporter), member 10, transcript variant 2 |
Clone name | hj04493 |
Vector information | |
cDNA sequence | DNA sequence (5231 bp) Predicted protein sequence (835 aa) |
HaloTag ORF Clone |
FHC00208
|
Flexi ORF Clone | FXC00208 |
Source | Human adult brain |
Rouge ID |
mKIAA1265
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2657 bp |
---|---|
Genome contig ID | gi89161199f_196130184 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (180481 - 180530) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 196230184 | 196310663 | 10 | 99.5 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003689 | 408 | 823 | PF02535 | Zinc/iron permease |
ScanRegExp | IPR007087 | 14 | 35 | PS00028 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 11 | TKFCLICLLTFIFHHCNHCHEE | 32 | SECONDARY | 22 | 2 | 410 | AWICGIISITVISLLSLLGVILV | 432 | PRIMARY | 23 | 3 | 443 | LLTFLVALAVGTMSGDALLHLLP | 465 | SECONDARY | 23 | 4 | 497 | DAVLKGLVALGGIYLLFIIEHCI | 519 | SECONDARY | 23 | 5 | 691 | AIGAAFSAGLTGGISTSIAVFCH | 713 | SECONDARY | 23 | 6 | 738 | YNLLSAMMAYIGMLIGTAVGQYA | 760 | PRIMARY | 23 | 7 | 764 | TLWIFAVTAGMFLYVALVDMLPE | 786 | PRIMARY | 23 | 8 | 801 | PVGQFILQNLGLLFGFAIMLVIA | 823 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CATCTCATTGCTTGGCCCTTC |
---|---|
Primer_r | AATGCAGAATCCTACCGTGGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CATCTCATTGCTTGGCCCTTC |
Primer_r | AATGCAGAATCCTACCGTGGG |
PCR product length | 165 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |