Order Kazusa clone(s) from : ![]() |
Product ID | ORK00208 |
---|---|
Accession No | AB033091 |
Description | solute carrier family 39 (zinc transporter), member 10, transcript variant 2 |
Clone name | hj04493 |
Vector information | |
cDNA sequence | DNA sequence (5231 bp) Predicted protein sequence (835 aa) |
HaloTag ORF Clone |
FHC00208
![]() |
Flexi ORF Clone | FXC00208 |
Source | Human adult brain |
Rouge ID |
mKIAA1265
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2657 bp |
---|---|
Genome contig ID | gi89161199f_196130184 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (180481 - 180530) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 196230184 | 196310663 | 10 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003689 | 408 | 823 | PF02535 | Zinc/iron permease |
ScanRegExp | IPR007087 | 14 | 35 | PS00028 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 11 | TKFCLICLLTFIFHHCNHCHEE | 32 | SECONDARY | 22 | 2 | 410 | AWICGIISITVISLLSLLGVILV | 432 | PRIMARY | 23 | 3 | 443 | LLTFLVALAVGTMSGDALLHLLP | 465 | SECONDARY | 23 | 4 | 497 | DAVLKGLVALGGIYLLFIIEHCI | 519 | SECONDARY | 23 | 5 | 691 | AIGAAFSAGLTGGISTSIAVFCH | 713 | SECONDARY | 23 | 6 | 738 | YNLLSAMMAYIGMLIGTAVGQYA | 760 | PRIMARY | 23 | 7 | 764 | TLWIFAVTAGMFLYVALVDMLPE | 786 | PRIMARY | 23 | 8 | 801 | PVGQFILQNLGLLFGFAIMLVIA | 823 | PRIMARY | 23 |
---|
![]() |
Primer_f | CATCTCATTGCTTGGCCCTTC |
---|---|
Primer_r | AATGCAGAATCCTACCGTGGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CATCTCATTGCTTGGCCCTTC |
Primer_r | AATGCAGAATCCTACCGTGGG |
PCR product length | 165 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |