Order Kazusa clone(s) from : ![]() |
Product ID | ORK01623 |
---|---|
Accession No | AB028987 |
Description | zinc finger CCCH-type containing 4 |
Clone name | hj05008s1 |
Vector information | |
cDNA sequence | DNA sequence (6115 bp) Predicted protein sequence (1315 aa) |
HaloTag ORF Clone |
FHC01623
![]() |
Flexi ORF Clone | FXC01623 |
Source | Human adult brain |
Rouge ID |
mKIAA1064
by Kazusa Mouse cDNA Project
|
Note | We replaced hj05008, former representative clones for KIAA1064 with hj05008s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2165 bp |
---|---|
Genome contig ID | gi42406306r_52159289 |
PolyA signal sequence (ATTAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 52259289 | 52308849 | 15 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TTAAGTTCTGGTCAGTGTGGC |
---|---|
Primer_r | GTTCAATACCTTCCCAGACAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |