KIAA1064

Product ID	ORK01623
Accession No	AB028987
Description	zinc finger CCCH-type containing 4
Clone name	hj05008s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6115 bp) Predicted protein sequence (1315 aa)
HaloTag ORF Clone	FHC01623
Flexi ORF Clone	FXC01623
Source	Human adult brain
Rouge ID	mKIAA1064 by Kazusa Mouse cDNA Project
Note	We replaced hj05008, former representative clones for KIAA1064 with hj05008s1. (2002/5/10)

Length: 6115 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2165 bp
Genome contig ID	gi42406306r_52159289
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- ATTGTATTACTGCCATTAAAGGATGCAGTTATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAGCTTGTGGGTCTGGTCTCTCCAGGCTGCCCCAGACCATCCCTTGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	52259289	52308849	15	99.3	Perfect prediction

Length: 1315 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPT8	100.0	Zinc finger CCC...	Homo sapiens
XP_001109916	98.5	similar to Zinc...	Macaca mulatta
XP_599954	92.8	similar to zinc...	Bos taurus
Q6ZPZ3	90.7	Zinc finger CCC...	Mus musculus
XP_001053214	90.1	similar to Zinc...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB111887	1.1e-17	34.0	KIAA2035
AB032998	0.00094	23.8	KIAA1172

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000571	403	428	PF00642	Zinc finger
	IPR000571	432	457	PF00642	Zinc finger
	IPR000571	459	481	PF00642	Zinc finger
HMMSmart	IPR000571	403	428	SM00356	Zinc finger
	IPR000571	432	457	SM00356	Zinc finger
	IPR000571	458	481	SM00356	Zinc finger

Primer_f	TTAAGTTCTGGTCAGTGTGGC
Primer_r	GTTCAATACCTTCCCAGACAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-