KIAA0955

Product ID	ORK00695
Accession No	AB023172
Description	caspase recruitment domain family, member 8
Clone name	hj05544
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5059 bp) Predicted protein sequence (485 aa)
HaloTag ORF Clone	FHC00695
Flexi ORF Clone	FXC00695
Source	Human adult brain

Length: 5059 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3450 bp
Genome contig ID	gi42406306r_53303325
PolyA signal sequence (CATAAA,-23)	+--------+--------+----*----+---- GGCGTTAGAATTCATAAAAGTCTTTATATGCTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCTGCAGCTCCATCCTCTTCATGATTGTGATCGTAAGGACAGTGGAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	53403325	53444737	10	99.2	Perfect prediction

Length: 485 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
ABW96892	4e-193	99.1	CARD8 isoform T...	Homo sapiens
Q9Y2G2	7.9e-186	100.0	Caspase recruit...	Homo sapiens
AAL02427	2.5e-184	99.3	CARD-inhibitor ...	Homo sapiens
XP_001170553	2.7e-182	97.9	caspase recruit...	Pan troglodytes
XP_001170291	6.3e-181	92.7	caspase recruit...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023143	9.5e-34	38.5	KIAA0926

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001315	399	483	PF00619	Caspase Recruitment
ProfileScan	IPR001315	401	484	PS50209	Caspase Recruitment

Primer_f	GGTAAATCAACTCCACAGAAC
Primer_r	GGTAGAATCCAAATGTCAGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-