KIAA0836

Product ID	ORK05297
Accession No	AB020643
Description	glucuronic acid epimerase
Clone name	hj06165
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4791 bp) Predicted protein sequence (609 aa)
Source	Human adult brain
Rouge ID	mKIAA0836 by Kazusa Mouse cDNA Project

Length: 4791 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2960 bp
Genome contig ID	gi51511731f_67235223
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATAAAACTGTAAAATAAAGTTTTTTTCTTAAAAAG
Flanking genome sequence (116377 - 116426)	----+--------+--------+--------+--------+----* AATATACCTGGATATTTCTCTTTCTTCTCAAATTATTCTAAGGTTATTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	67335223	67351598	3	99.2	Perfect prediction

Length: 609 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94923	100.0	D-glucuronyl C5...	Homo sapiens
AAT48654	99.8	glucuronyl C5-e...	Homo sapiens
XP_001085491	99.3	D-glucuronyl C5...	Macaca mulatta
XP_852992	97.5	similar to D-gl...	Canis lupus fam...
O18756	97.0	D-glucuronyl C5...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010598	408	599	PF06662	D-glucuronyl C5-epimerase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	4	TLIIICALFTLVTVLLWNKCSSD	26	PRIMARY	23

Primer_f	TCATACGTCTGCTTTGTTTGC
Primer_r	GGAAGGCAGTGTAAAACCAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-