KIAA0967

Product ID	ORK00702
Accession No	AB023184
Description	FERM and PDZ domain containing 1
Clone name	hj06404
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4916 bp) Predicted protein sequence (1578 aa)
HaloTag ORF Clone	FHC00702
Flexi ORF Clone	FXC00702
Source	Human adult brain
Rouge ID	mKIAA0967 by Kazusa Mouse cDNA Project

Length: 4916 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	135 bp
Genome contig ID	gi89161216f_37541052
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TATAGAGTATTCAAATAAACTGCTGCTTAATCTTG
Flanking genome sequence (195851 - 195900)	----+--------+--------+--------+--------+----* GCCTGAGTCATAGAGTTTGGGTTAAAAGCATTCACTTATATTCGTTCAAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	37641052	37736901	16	99.3	Perfect prediction

Length: 1578 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5SYB0	99.9	FERM and PDZ do...	Homo sapiens
AAI14966	99.9	FERM and PDZ do...	Homo sapiens
CAI46019	99.7	hypothetical pr...	Homo sapiens
XP_520428	98.9	FERM and PDZ do...	Pan troglodytes
XP_001114750	96.7	similar to FERM...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002314	1e-48	30.3	KIAA0316

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	57	132	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	67	135	SM00228	PDZ/DHR/GLGF
HMMSmart	IPR000299	177	401	SM00295	Band 4.1
ProfileScan	IPR001478	57	135	PS50106	PDZ/DHR/GLGF
ProfileScan	IPR000299	181	496	PS50057	Band 4.1

Primer_f	ACAGGGACTTGGAAGCACACC
Primer_r	CAGATGTGGCTTTTCCTCGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACAGGGACTTGGAAGCACACC
Primer_r	CAGATGTGGCTTTTCCTCGAC
PCR product length	136 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles