Gene/Protein Characteristic Table for KIAA0969
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00703
Accession No AB023186
Description pleckstrin homology domain containing, family A member 6
Clone name hj06525
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5047 bp)
Predicted protein sequence (1091 aa)
Flexi ORF Clone FXC00703
Source Human adult brain
Rouge ID mKIAA0969 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5047 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1583 bp
Genome contig ID gi89161185r_202356972
PolyA signal sequence
(AGTAAA,-24)
+----*----+----*----+----*----+----
GTTCATATGCAAGTAAAGATGACAATTTACTCAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATATTTATCGAGCACCTTTTATGTACCAGGCACTGTTGTAGGTGCTTA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 1 r 202456972 202595667 24 99.6 Internal No-hit
Features of the protein sequence
Description

Length: 1091 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW91509 0 99.9 pleckstrin homo...
Homo sapiens
AAI52476 0 100.0 Pleckstrin homo...
Homo sapiens
EAW91510 0 99.9 pleckstrin homo...
Homo sapiens
Q9Y2H5 0 99.8 Pleckstrin homo...
Homo sapiens
XP_001488918 0 92.2 similar to Plec...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB051473 2.2e-14 31.3 KIAA1686
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001849 103 201 PF00169 Pleckstrin-like
HMMSmart IPR001849 103 203 SM00233 Pleckstrin-like
ProfileScan IPR001849 102 201 PS50003 Pleckstrin-like
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGGCTAGGCGCTCTCATGATC
Primer_r GGCTACATTCGTCTCCAGGTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp