Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04763 |
---|---|
Accession No | AB018261 |
Description | diacylglycerol kinase, beta 90kDa |
Clone name | hk01073 |
Vector information | |
cDNA sequence | DNA sequence (3742 bp) Predicted protein sequence (742 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0718
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR002048 | 92 | 156 | PD000012 | Calcium-binding EF-hand |
IPR001206 | 368 | 471 | PD005043 | Diacylglycerol kinase | |
IPR000756 | 677 | 719 | PD002939 | Diacylglycerol kinase accessory region | |
FPrintScan | IPR002219 | 180 | 194 | PR00008 | Protein kinase C |
IPR002219 | 196 | 205 | PR00008 | Protein kinase C | |
IPR002219 | 209 | 220 | PR00008 | Protein kinase C | |
IPR002219 | 221 | 233 | PR00008 | Protein kinase C | |
HMMPfam | IPR002048 | 91 | 119 | PF00036 | Calcium-binding EF-hand |
IPR002048 | 136 | 164 | PF00036 | Calcium-binding EF-hand | |
IPR002219 | 183 | 235 | PF00130 | Protein kinase C | |
IPR002219 | 248 | 299 | PF00130 | Protein kinase C | |
IPR001206 | 376 | 500 | PF00781 | Diacylglycerol kinase | |
IPR000756 | 520 | 700 | PF00609 | Diacylglycerol kinase accessory region | |
HMMSmart | IPR002048 | 91 | 119 | SM00054 | Calcium-binding EF-hand |
IPR002048 | 136 | 164 | SM00054 | Calcium-binding EF-hand | |
IPR002219 | 181 | 232 | SM00109 | Protein kinase C | |
IPR002219 | 248 | 296 | SM00109 | Protein kinase C | |
IPR001206 | 376 | 500 | SM00046 | Diacylglycerol kinase | |
IPR000756 | 520 | 700 | SM00045 | Diacylglycerol kinase accessory region | |
ProfileScan | IPR002048 | 87 | 122 | PS50222 | Calcium-binding EF-hand |
IPR002048 | 132 | 167 | PS50222 | Calcium-binding EF-hand | |
IPR002219 | 182 | 232 | PS50081 | Protein kinase C | |
IPR002219 | 247 | 296 | PS50081 | Protein kinase C | |
ScanRegExp | IPR002048 | 100 | 112 | PS00018 | Calcium-binding EF-hand |
IPR002048 | 145 | 157 | PS00018 | Calcium-binding EF-hand | |
IPR002219 | 183 | 232 | PS00479 | Protein kinase C | |
IPR002219 | 247 | 298 | PS00479 | Protein kinase C |
RT-PCR-ELISA |
Primer_f | ATGCAATTAGCTCCCTCCTCC |
---|---|
Primer_r | AGAGACTCCAACTATGCCATG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATGCAATTAGCTCCCTCCTCC |
Primer_r | AGAGACTCCAACTATGCCATG |
PCR product length | 121 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |