|
Order Kazusa clone(s) from : |
| Product ID | ORK04763 |
|---|---|
| Accession No | AB018261 |
| Description | diacylglycerol kinase, beta 90kDa |
| Clone name | hk01073 |
| Vector information | |
| cDNA sequence | DNA sequence (3742 bp) Predicted protein sequence (742 aa) |
| Source | Human adult brain |
| Rouge ID |
mKIAA0718
by Kazusa Mouse cDNA Project
|
Length: 3742 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 742 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR002048 | 92 | 156 | PD000012 | Calcium-binding EF-hand |
| IPR001206 | 368 | 471 | PD005043 | Diacylglycerol kinase | |
| IPR000756 | 677 | 719 | PD002939 | Diacylglycerol kinase accessory region | |
| FPrintScan | IPR002219 | 180 | 194 | PR00008 | Protein kinase C |
| IPR002219 | 196 | 205 | PR00008 | Protein kinase C | |
| IPR002219 | 209 | 220 | PR00008 | Protein kinase C | |
| IPR002219 | 221 | 233 | PR00008 | Protein kinase C | |
| HMMPfam | IPR002048 | 91 | 119 | PF00036 | Calcium-binding EF-hand |
| IPR002048 | 136 | 164 | PF00036 | Calcium-binding EF-hand | |
| IPR002219 | 183 | 235 | PF00130 | Protein kinase C | |
| IPR002219 | 248 | 299 | PF00130 | Protein kinase C | |
| IPR001206 | 376 | 500 | PF00781 | Diacylglycerol kinase | |
| IPR000756 | 520 | 700 | PF00609 | Diacylglycerol kinase accessory region | |
| HMMSmart | IPR002048 | 91 | 119 | SM00054 | Calcium-binding EF-hand |
| IPR002048 | 136 | 164 | SM00054 | Calcium-binding EF-hand | |
| IPR002219 | 181 | 232 | SM00109 | Protein kinase C | |
| IPR002219 | 248 | 296 | SM00109 | Protein kinase C | |
| IPR001206 | 376 | 500 | SM00046 | Diacylglycerol kinase | |
| IPR000756 | 520 | 700 | SM00045 | Diacylglycerol kinase accessory region | |
| ProfileScan | IPR002048 | 87 | 122 | PS50222 | Calcium-binding EF-hand |
| IPR002048 | 132 | 167 | PS50222 | Calcium-binding EF-hand | |
| IPR002219 | 182 | 232 | PS50081 | Protein kinase C | |
| IPR002219 | 247 | 296 | PS50081 | Protein kinase C | |
| ScanRegExp | IPR002048 | 100 | 112 | PS00018 | Calcium-binding EF-hand |
| IPR002048 | 145 | 157 | PS00018 | Calcium-binding EF-hand | |
| IPR002219 | 183 | 232 | PS00479 | Protein kinase C | |
| IPR002219 | 247 | 298 | PS00479 | Protein kinase C |
RT-PCR-ELISA
|
Experimental conditions| Primer_f | ATGCAATTAGCTCCCTCCTCC |
|---|---|
| Primer_r | AGAGACTCCAACTATGCCATG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 7
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | ATGCAATTAGCTCCCTCCTCC |
| Primer_r | AGAGACTCCAACTATGCCATG |
| PCR product length | 121 bp |
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |