KIAA0722

Product ID	ORK00613
Accession No	AB018265
Description	unc-51 like autophagy activating kinase 1
Clone name	hk02030s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4821 bp) Predicted protein sequence (1066 aa)
HaloTag ORF Clone	FHC00613
Flexi ORF Clone	FXC00613
Source	Human adult brain
Rouge ID	mKIAA0722 by Kazusa Mouse cDNA Project
Note	We replaced hk02030, former representative clones for KIAA0722 with hk02030s1. (2002/5/10)

Length: 4821 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1618 bp
Genome contig ID	gi89161190f_130845494
PolyA signal sequence (None)	+--------+--------+----*----+---- CGGTGTCCTGGTCCTCTTGCTTCCGTCGCGGCCGC
Flanking genome sequence (127985 - 128034)	----+--------+--------+--------+--------+----* ATGTGCGTGTGTCCAAGCAGGTCCTGGGCGCCTCAACTGCTGCCCCTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	130945450	130973477	28	99.6	Perfect prediction

Length: 1066 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75385	100.0	Serine/threonin...	Homo sapiens
AAI11604	99.9	ULK1 protein [s...	synthetic construct
XP_001928586	90.6	unc-51-like kin...	Sus scrofa
XP_604678	90.2	similar to unc-...	Bos taurus
XP_001105326	97.6	similar to unc-...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014523	1.9e-54	52.4	KIAA0623
AB051552	2e-08	31.5	KIAA1765
AB046859	2.1e-08	25.3	KIAA1639
D43636	2.1e-07	33.1	KIAA0096
AB067488	3.1e-07	31.5	KIAA1901

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	32	293	PD000001	Protein kinase
HMMPfam	IPR000719	32	294	PF00069	Protein kinase
HMMSmart	IPR001245	32	294	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	32	294	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	32	294	PS50011	Protein kinase
ScanRegExp	IPR000719	38	62	PS00107	Protein kinase
ScanRegExp	IPR008271	150	162	PS00108	Serine/threonine protein kinase

Primer_f	TTTGTTCAAGCGTTCCTCTGG
Primer_r	CCTGTGCCATCTGCCTCTAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTTGTTCAAGCGTTCCTCTGG
Primer_r	CCTGTGCCATCTGCCTCTAAC
PCR product length	209 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles