KIAA1639

Product ID	ORK06217
Accession No	AB046859
Description	Obscurin (Obscurin-myosin light chain kinase) (Obscurin-MLCK) (Obscurin-RhoGEF).
Clone name	af14886
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7835 bp) Predicted protein sequence (2584 aa)
Source	Human brain (amygdala)
Note	We replaced fj06072, former representative clones for KIAA1639 with af14886. (2005/08/06)

Length: 7835 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	79 bp
Genome contig ID	gi89161185f_226489402
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GCAGACGCGCCAATAAAAACGCACAGCCGGGCGAG
Flanking genome sequence (143798 - 143847)	----+--------+--------+--------+--------+----* AAGTCTTCCGTCTCGTTGCATTATTTTCTTTTGGGGAGGAGAGGGAGTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	226589206	226633198	45	99.7	Perfect prediction

Length: 2584 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001092093	99.9	obscurin, cytos...	Homo sapiens
Q5VST9	99.9	Obscurin; Obscu...	Homo sapiens
CAH71670	99.8	obscurin, cytos...	Homo sapiens
CAJ76912	99.8	obscurin isofor...	Homo sapiens
CAM24490	78.1	obscurin, cytos...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037718	1.7e-11	28.4	KIAA1297
AB018265	1.7e-07	25.2	KIAA0722
AB033104	6e-07	33.5	KIAA1278
AB058763	1.1e-06	26.2	KIAA1860
AB023185	1.8e-06	30.7	KIAA0968

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	1084	1337	PD000001	Protein kinase
BlastProDom	IPR000719	2297	2531	PD000001	Protein kinase
HMMPfam	IPR013098	1	81	PF07679	Immunoglobulin I-set
	IPR000219	312	492	PF00621	DH
	IPR001849	512	620	PF00169	Pleckstrin-like
	IPR013098	630	722	PF07679	Immunoglobulin I-set
	IPR013098	724	815	PF07679	Immunoglobulin I-set
	IPR013098	973	1062	PF07679	Immunoglobulin I-set
	IPR000719	1084	1337	PF00069	Protein kinase
	IPR013098	2079	2169	PF07679	Immunoglobulin I-set
	IPR000719	2288	2490	PF00069	Protein kinase
HMMSmart	IPR003599	1	82	SM00409	Immunoglobulin subtype
	IPR003598	8	71	SM00408	Immunoglobulin subtype 2
	IPR000219	312	492	SM00325	DH
	IPR001849	512	622	SM00233	Pleckstrin-like
	IPR003599	636	723	SM00409	Immunoglobulin subtype
	IPR003598	642	710	SM00408	Immunoglobulin subtype 2
	IPR003599	730	816	SM00409	Immunoglobulin subtype
	IPR003598	736	805	SM00408	Immunoglobulin subtype 2
	IPR003599	979	1063	SM00409	Immunoglobulin subtype
	IPR003598	985	1052	SM00408	Immunoglobulin subtype 2
	IPR001245	1084	1337	SM00219	Tyrosine protein kinase
	IPR002290	1084	1337	SM00220	Serine/threonine protein kinase
	IPR003599	2085	2171	SM00409	Immunoglobulin subtype
	IPR003598	2091	2159	SM00408	Immunoglobulin subtype 2
	IPR002290	2288	2540	SM00220	Serine/threonine protein kinase
ProfileScan	IPR007110	1	82	PS50835	Immunoglobulin-like
	IPR000219	308	493	PS50010	DH
	IPR001849	511	620	PS50003	Pleckstrin-like
	IPR007110	630	713	PS50835	Immunoglobulin-like
	IPR007110	724	816	PS50835	Immunoglobulin-like
	IPR007110	973	1061	PS50835	Immunoglobulin-like
	IPR000719	1084	1337	PS50011	Protein kinase
	IPR007110	2079	2168	PS50835	Immunoglobulin-like
	IPR003961	2173	2260	PS50853	Fibronectin
	IPR000719	2288	2540	PS50011	Protein kinase
ScanRegExp	IPR001547	1061	1070	PS00659	Glycoside hydrolase
	IPR000719	1090	1113	PS00107	Protein kinase
	IPR008271	1199	1211	PS00108	Serine/threonine protein kinase
	IPR008266	2403	2415	PS00109	Tyrosine protein kinase

Primer_f	GTTCCTGAAATCCATGCCTGC
Primer_r	CTTGTAGCTCATCAGGGAACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	ATATCAAGTACCTCCCATTCG
Primer_r	CTCTGACTCCTCTGTGATCTC
PCR product length	176 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles