Gene/Protein Characteristic Table for KIAA0665
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00598
Accession No AB014565
Description RAB11 family interacting protein 3 (class II), transcript variant 1
Clone name hk02064
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4080 bp)
Predicted protein sequence (760 aa)
Flexi ORF Clone FXC00598
Source Human adult brain
Rouge ID mKIAA0665 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4080 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 760 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O75154 2.9e-193 100.0 Rab11 family-in...
Homo sapiens
XP_001118464 3.9e-152 92.4 rab11-family in...
Macaca mulatta
XP_001496965 2.8e-134 84.1 similar to Rab1...
Equus caballus
EAW85807 1.2e-107 99.8 RAB11 family in...
Homo sapiens
BAG64178 1.3e-107 99.8 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB058724 6.5e-19 39.8 KIAA1821
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002048 210 238 PF00036 Calcium-binding EF-hand
ProfileScan IPR002048 206 241 PS50222 Calcium-binding EF-hand
IPR002048 248 273 PS50222 Calcium-binding EF-hand
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f ACCTGAGATGACCGCTGTGTG
Primer_r CGATGTTTGGATTCTGGCCTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name GeneBridge 4
Primer_f ACCTGAGATGACCGCTGTGTG
Primer_r CGATGTTTGGATTCTGGCCTG
PCR product length 159 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp