Gene/Protein Characteristic Table for KIAA0669
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00601
Accession No AB014569
Description TSC22 domain family, member 2, transcript variant 1
Clone name hk02346
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4550 bp)
Predicted protein sequence (825 aa)
Flexi ORF Clone FXC00601
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 4550 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 825 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O75157 7e-196 100.0 TSC22 domain fa...
Homo sapiens
EAW78837 2.6e-170 100.0 TSC22 domain fa...
Homo sapiens
XP_001925665 2.8e-168 87.1 similar to TSC2...
Sus scrofa
EAW78840 3.4e-163 96.9 TSC22 domain fa...
Homo sapiens
NP_001137573 5.5e-161 84.7 TSC22 domain fa...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB082525 4e-08 31.6 KIAA1994
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000580 739 793 PD007152 TSC-22 / Dip / Bun
HMMPfam IPR000580 739 799 PF01166 TSC-22 / Dip / Bun
ScanRegExp IPR000580 739 755 PS01289 TSC-22 / Dip / Bun
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f ATCCTGGTAGCACTTCTCAAC
Primer_r TGCTGAGGAGACATTCGGCTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name GeneBridge 4
Primer_f CCGGCTGAATTAGGCATCTCC
Primer_r CAATTCAATTCCCTCAGAGGC
PCR product length 294 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp