Gene/Protein Characteristic Table for KIAA0680
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00603
Accession No AB014580
Description phosphatase and actin regulator 2, transcript variant 3
Clone name hk02746
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4318 bp)
Predicted protein sequence (635 aa)
Flexi ORF Clone FXC00603
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 4318 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 635 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAI52417 5.2e-161 100.0 Phosphatase and...
Homo sapiens
O75167 9.2e-161 99.8 Phosphatase and...
Homo sapiens
AAI50631 1.6e-160 99.7 Phosphatase and...
Homo sapiens
CAI14133 4.5e-160 99.5 phosphatase and...
Homo sapiens
EAW47862 1.1e-159 99.7 phosphatase and...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB051520 1.4e-05 31.1 KIAA1733
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004018 61 86 PF02755 RPEL repeat
IPR004018 478 503 PF02755 RPEL repeat
IPR004018 516 541 PF02755 RPEL repeat
IPR004018 554 579 PF02755 RPEL repeat
HMMSmart IPR004018 61 86 SM00707 RPEL repeat
IPR004018 478 503 SM00707 RPEL repeat
IPR004018 516 541 SM00707 RPEL repeat
IPR004018 554 579 SM00707 RPEL repeat
ProfileScan IPR004018 61 86 PS51073 RPEL repeat
IPR004018 478 503 PS51073 RPEL repeat
IPR004018 516 541 PS51073 RPEL repeat
IPR004018 554 579 PS51073 RPEL repeat
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f CCTAGAGTCTGTTGTCATTTC
Primer_r TATGGCTGGATTGAAACACTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 6
Experimental conditions
Panel name GeneBridge 4
Primer_f CCTAGAGTCTGTTGTCATTTC
Primer_r TATGGCTGGATTGAAACACTG
PCR product length 130 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp