Order Kazusa clone(s) from : ![]() |
Product ID | ORK00603 |
---|---|
Accession No | AB014580 |
Description | phosphatase and actin regulator 2, transcript variant 3 |
Clone name | hk02746 |
Vector information | |
cDNA sequence | DNA sequence (4318 bp) Predicted protein sequence (635 aa) |
HaloTag ORF Clone |
FHC00603
![]() |
Flexi ORF Clone | FXC00603 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004018 | 61 | 86 | PF02755 | RPEL repeat |
IPR004018 | 478 | 503 | PF02755 | RPEL repeat | |
IPR004018 | 516 | 541 | PF02755 | RPEL repeat | |
IPR004018 | 554 | 579 | PF02755 | RPEL repeat | |
HMMSmart | IPR004018 | 61 | 86 | SM00707 | RPEL repeat |
IPR004018 | 478 | 503 | SM00707 | RPEL repeat | |
IPR004018 | 516 | 541 | SM00707 | RPEL repeat | |
IPR004018 | 554 | 579 | SM00707 | RPEL repeat | |
ProfileScan | IPR004018 | 61 | 86 | PS51073 | RPEL repeat |
IPR004018 | 478 | 503 | PS51073 | RPEL repeat | |
IPR004018 | 516 | 541 | PS51073 | RPEL repeat | |
IPR004018 | 554 | 579 | PS51073 | RPEL repeat |
![]() |
---|
![]() |
Primer_f | CCTAGAGTCTGTTGTCATTTC |
---|---|
Primer_r | TATGGCTGGATTGAAACACTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCTAGAGTCTGTTGTCATTTC |
Primer_r | TATGGCTGGATTGAAACACTG |
PCR product length | 130 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |