Gene/Protein Characteristic Table for KIAA0723
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00614
Accession No AB018266
Description matrin 3, transcript variant 2
Clone name hk02753
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3803 bp)
Predicted protein sequence (853 aa)
Flexi ORF Clone FXC00614
Source Human adult brain
Rouge ID mKIAA0723 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3803 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 853 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P43243 0 100.0 Matrin-3.
Homo sapiens
XP_001172281 0 99.6 matrin 3 isofor...
Pan troglodytes
XP_001114262 0 99.6 matrin 3 isofor...
Macaca mulatta
CAH18419 0 99.6 hypothetical pr...
Homo sapiens
CAH92673 0 99.3 hypothetical pr...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR003604 294 328 SM00451 Zinc finger
IPR000504 405 475 SM00360 RNA recognition motif
IPR000504 503 573 SM00360 RNA recognition motif
IPR003604 804 839 SM00451 Zinc finger
ProfileScan IPR000504 404 479 PS50102 RNA recognition motif
IPR000504 502 577 PS50102 RNA recognition motif
IPR000690 807 838 PS50171 Zinc finger
ScanRegExp IPR007087 299 321 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TTCTAATTCATGTACCTGCAC
Primer_r GGTATTCACTTCAGTAACTTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp