Order Kazusa clone(s) from : ![]() |
Product ID | ORK00605 |
---|---|
Accession No | AB014588 |
Description | ADAM metallopeptidase with thrombospondin type 1 motif, 4 |
Clone name | hk03410 |
Vector information | |
cDNA sequence | DNA sequence (4301 bp) Predicted protein sequence (849 aa) |
HaloTag ORF Clone |
FHC00605
![]() |
Flexi ORF Clone | FXC00605 |
Source | Human adult brain |
Rouge ID |
mKIAA0688
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1387 bp |
---|---|
Genome contig ID | gi89161185r_159326262 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99905 - 99856) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 159426167 | 159435441 | 9 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR013273 | 541 | 559 | PR01857 | Peptidase M12B |
IPR013273 | 658 | 677 | PR01857 | Peptidase M12B | |
IPR013273 | 678 | 697 | PR01857 | Peptidase M12B | |
HMMPfam | IPR002870 | 48 | 154 | PF01562 | Peptidase M12B |
IPR001590 | 230 | 440 | PF01421 | Peptidase M12B | |
IPR000884 | 536 | 586 | PF00090 | Thrombospondin | |
IPR010294 | 698 | 815 | PF05986 | ADAM-TS Spacer 1 | |
HMMSmart | IPR006586 | 453 | 521 | SM00608 | ADAM |
IPR000884 | 535 | 587 | SM00209 | Thrombospondin | |
ProfileScan | IPR001590 | 230 | 440 | PS50215 | Peptidase M12B |
IPR000884 | 532 | 587 | PS50092 | Thrombospondin | |
ScanRegExp | IPR006025 | 370 | 379 | PS00142 | Peptidase M |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 31 | GAQPCLLLPIVPLSWLVWLLLLL | 53 | PRIMARY | 23 |
---|
![]() |
---|
![]() |
Primer_f | ACCTGTTCTGCTTTCCTCTTC |
---|---|
Primer_r | AAGATAATCCCTCACTCCCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACCTGTTCTGCTTTCCTCTTC |
Primer_r | AAGATAATCCCTCACTCCCTG |
PCR product length | 91 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |