|
Order Kazusa clone(s) from : |
| Product ID | ORK00606 |
|---|---|
| Accession No | AB014590 |
| Description | ribosomal RNA processing 12 homolog, transcript variant 3 |
| Clone name | hk03594 |
| Vector information | |
| cDNA sequence | DNA sequence (4038 bp) Predicted protein sequence (1214 aa) |
|
HaloTag ORF Clone |
FHC00606
|
| Flexi ORF Clone | FXC00606 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0690
by Kazusa Mouse cDNA Project
|
Length: 4038 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 1214 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR000357 | 327 | 363 | PF02985 | HEAT |
| IPR012978 | 388 | 586 | PF08161 | Domain of unknown function |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 822 | LIYPGLVGAVTMVSCSILALTHL | 844 | PRIMARY | 23 |
|---|
RT-PCR
|
|---|
Experimental conditions| Primer_f | TGACTTGGAACTAGGGCTTGG |
|---|---|
| Primer_r | AGGCCACATTCCCATCTCCAG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 10
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | TGACTTGGAACTAGGGCTTGG |
| Primer_r | AGGCCACATTCCCATCTCCAG |
| PCR product length | 106 bp |
| PCR conditions | 95 °C 15 sec 66 °C 60 sec 30 cycles |