Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01992 |
---|---|
Accession No | AB018277 |
Description | BAI1-associated protein 3, transcript variant 1 |
Clone name | hk03764s2 |
Vector information | |
cDNA sequence | DNA sequence (4530 bp) Predicted protein sequence (1190 aa) |
HaloTag ORF Clone |
FHC01992
|
Flexi ORF Clone | FXC01992 |
Source | Human adult brain |
Rouge ID |
mKIAA0734
by Kazusa Mouse cDNA Project
|
Note | We replaced hk03764s1 and hk03764, former representative clones for KIAA0734 with hk03764s2. (2008/8/27,2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 956 bp |
---|---|
Genome contig ID | gi51511732f_1224654 |
PolyA signal sequence (AATATA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (114788 - 114837) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000008 | 1045 | 1057 | PR00360 | C2 calcium-dependent membrane targeting |
IPR000008 | 1076 | 1089 | PR00360 | C2 calcium-dependent membrane targeting | |
HMMPfam | IPR000008 | 200 | 309 | PF00168 | C2 calcium-dependent membrane targeting |
IPR010439 | 564 | 645 | PF06292 | Protein of unknown function DUF1041 | |
IPR000008 | 1030 | 1122 | PF00168 | C2 calcium-dependent membrane targeting | |
HMMSmart | IPR000008 | 199 | 368 | SM00239 | C2 calcium-dependent membrane targeting |
IPR000008 | 1029 | 1137 | SM00239 | C2 calcium-dependent membrane targeting | |
ProfileScan | IPR000008 | 200 | 317 | PS50004 | C2 calcium-dependent membrane targeting |
IPR014770 | 666 | 787 | PS51258 | Munc13 homology 1 | |
IPR014772 | 891 | 999 | PS51259 | Munc13 homology 2 | |
IPR000008 | 1029 | 1122 | PS50004 | C2 calcium-dependent membrane targeting |
Primer_f | TACAGCCGCTTCCATTTCACG |
---|---|
Primer_r | GCGGGTGGAACATTTGTGCAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTGAGCGTCCGTTGCCATTAC |
Primer_r | GACCAGTGGAAAGAGATGCGG |
PCR product length | 150 (0.3k) bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |