KIAA0741

Product ID	ORK00619
Accession No	AB018284
Description	eukaryotic translation initiation factor 5B
Clone name	hk04024
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4177 bp) Predicted protein sequence (1222 aa)
HaloTag ORF Clone	FHC00619
Flexi ORF Clone	FXC00619
Source	Human adult brain
Rouge ID	mKIAA0741 by Kazusa Mouse cDNA Project

Length: 4177 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	364 bp
Genome contig ID	gi89161199f_99220300
PolyA signal sequence (ATTAAA,-31)	+--------+--------+----*----+---- ACTGATTAAATCAGTACTGCAGTATTTGATTAACC
Flanking genome sequence (162375 - 162424)	----+--------+--------+--------+--------+----* AAGCTTCTGCAGATTTTGTGATTCTTGGGACTTTTTTGACGTAAGAAATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	99320300	99382673	24	100.0	Perfect prediction

Length: 1222 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09828	100.0	eukaryotic tran...	synthetic construct
EAX01867	99.9	eukaryotic tran...	Homo sapiens
O60841	99.8	Eukaryotic tran...	Homo sapiens
AAH32639	99.8	Eukaryotic tran...	Homo sapiens
CAB44357	99.7	IF2 protein [Ho...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000178	823	906	PD186100	Initiation factor 2
FPrintScan	IPR000795	635	648	PR00315	Protein synthesis factor
	IPR000795	701	711	PR00315	Protein synthesis factor
	IPR000795	717	728	PR00315	Protein synthesis factor
	IPR000795	753	762	PR00315	Protein synthesis factor
HMMPfam	IPR000795	631	848	PF00009	Protein synthesis factor
HMMPfam	IPR004161	872	950	PF03144	Translation elongation factor EFTu/EF1A
HMMTigr	IPR005225	631	806	TIGR00231	Small GTP-binding protein domain

Primer_f	GTGACTGGCAGCTTATTGTGG
Primer_r	CCATCAGTGTCCAAATACGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-