Gene/Protein Characteristic Table for KIAA0744
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00124
Accession No AB018287
Description histone deacetylase 9, transcript variant 3
Clone name hk04110
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4238 bp)
Predicted protein sequence (619 aa)
Flexi ORF Clone FXC00124
Source Human adult brain
Rouge ID mKIAA0744 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4238 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 619 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001104526 3.3e-189 99.0 similar to hist...
Macaca mulatta
ACE86818 4.7e-188 99.2 histone deacety...
synthetic construct
XP_862756 5.4e-187 98.8 similar to hist...
Canis lupus fam...
EAW93702 3.8e-185 100.0 histone deacety...
Homo sapiens
EAW93709 2.4e-184 99.5 histone deacety...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB006626 2.1e-45 51.1 KIAA0288
AB011172 1.8e-35 50.5 KIAA0600
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TAGGGAAATTGTTACGGAAGC
Primer_r ACTACACCTTGAAATACCTCG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 7
Experimental conditions
Panel name GeneBridge 4
Primer_f TAGGGAAATTGTTACGGAAGC
Primer_r ACTACACCTTGAAATACCTCG
PCR product length 220 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp