Gene/Protein Characteristic Table for KIAA0748
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05619
Accession No AB018291
Description thymocyte expressed, positive selection associated 1
Clone name hk04254
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4183 bp)
Predicted protein sequence (472 aa)
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 4183 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 472 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001092963 9e-185 96.0 similar to sper...
Macaca mulatta
EAW96797 6.3e-178 96.3 hCG21937, isofo...
Homo sapiens
EAW96796 9.5e-157 100.0 hCG21937, isofo...
Homo sapiens
BAG58082 4.4e-110 100.0 unnamed protein...
Homo sapiens
XP_543615 4.2e-95 72.5 similar to sper...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB067514 2.4e-17 30.6 KIAA1927
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGCAGTATGTGGTTTCAGAGC
Primer_r CTCACAATTTATTAGGCAGCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 12
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp