KIAA0840

Product ID	ORK01999
Accession No	AB020647
Description	F-box and leucine-rich repeat protein 7, transcript variant 1
Clone name	hk04921s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4562 bp) Predicted protein sequence (523 aa)
HaloTag ORF Clone	FHC01999
Flexi ORF Clone	FXC01999
Source	Human adult brain
Rouge ID	mKIAA0840 by Kazusa Mouse cDNA Project
Note	We replaced hk04921, former representative clones for KIAA0840 with hk04921s1. (2002/5/10)

Length: 4562 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2605 bp
Genome contig ID	gi51511721f_15453305
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TAATTTACTACCAAGAAATAAAGCAATATGTTCGT
Flanking genome sequence (539597 - 539646)	----+--------+--------+--------+--------+----* AATCAGCCTCAGCTTCATTTTTAATAACCTTTCCAGAGGAGAGTGCTGTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	15553305	15992900	4	100.0	Perfect prediction

Length: 523 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UJT9	1.6e-193	100.0	F-box/LRR-repea...	Homo sapiens
EDL82624	4.9e-191	98.6	F-box and leuci...	Rattus norvegicus
Q5BJ29	6.5e-191	98.4	F-box/LRR-repea...	Mus musculus
EDL08903	1.5e-190	98.2	F-box and leuci...	Mus musculus
AAF04514	3.4e-190	100.0	F-box protein F...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001810	144	191	PF00646	Cyclin-like F-box
HMMSmart	IPR001810	149	189	SM00256	Cyclin-like F-box
	IPR006553	217	242	SM00367	Leucine-rich repeat
	IPR006553	243	268	SM00367	Leucine-rich repeat
	IPR006553	269	294	SM00367	Leucine-rich repeat
	IPR006553	303	328	SM00367	Leucine-rich repeat
	IPR006553	329	354	SM00367	Leucine-rich repeat
	IPR006553	355	380	SM00367	Leucine-rich repeat
	IPR006553	381	406	SM00367	Leucine-rich repeat
	IPR006553	407	432	SM00367	Leucine-rich repeat
	IPR006553	433	458	SM00367	Leucine-rich repeat
	IPR006553	459	484	SM00367	Leucine-rich repeat
	IPR006553	485	509	SM00367	Leucine-rich repeat
ProfileScan	IPR001810	143	189	PS50181	Cyclin-like F-box

Primer_f	CTGTTCATCCATTCTGTTCTC
Primer_r	TAGCAGAGCCAGGAAGGAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-