KIAA0990

Product ID	ORK01620
Accession No	AB023207
Description	chondroitin sulfate synthase 1
Clone name	hk05454
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4565 bp) Predicted protein sequence (883 aa)
HaloTag ORF Clone	FHC01620
Flexi ORF Clone	FXC01620
Source	Human adult brain
Rouge ID	mKIAA0990 by Kazusa Mouse cDNA Project

Length: 4565 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1662 bp
Genome contig ID	gi51511731r_99433456
PolyA signal sequence (AGTAAA,-19)	+--------+--------+----*----+---- TGTATTACATTTGGAGAGTAAAAAACTTAAACACG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCATAAAGTTTTTCAAGTTATTTGAGGGAAATGCTTCTGTGGACCGCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	99533456	99609660	3	98.8	Perfect prediction

Length: 883 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB64936	100.0	chondroitin syn...	Homo sapiens
Q86X52	99.9	Chondroitin sul...	Homo sapiens
AAQ88893	99.8	CHSY1 [Homo sap...	Homo sapiens
XP_545821	95.1	similar to carb...	Canis lupus fam...
XP_001250941	96.0	chondroitin sul...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037823	3.2e-18	25.2	KIAA1402

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008428	319	858	PF05679	Chondroitin N-acetylgalactosaminyltransferase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	90	WLSVLLGLVLGFVLASRLVLPRA	112	PRIMARY	23

Primer_f	GTTGTCCAGGCAGGTTTGAAG
Primer_r	AGCTGCTGTGTGGACCCATAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-