Order Kazusa clone(s) from : ![]() |
Product ID | ORK00227 |
---|---|
Accession No | AB037823 |
Description | chondroitin polymerizing factor 2, transcript variant 1 |
Clone name | hk09846 |
Vector information | |
cDNA sequence | DNA sequence (3970 bp) Predicted protein sequence (788 aa) |
HaloTag ORF Clone |
FHC00227
![]() |
Flexi ORF Clone | FXC00227 |
Source | Human adult brain |
Rouge ID |
mKIAA1402
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 138 bp |
---|---|
Genome contig ID | gi89161213f_150460518 |
PolyA signal sequence (ATTAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (106322 - 106371) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 150560518 | 150566838 | 4 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR008428 | 258 | 775 | PF05679 | Chondroitin N-acetylgalactosaminyltransferase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 23 | LALLRPALPLILGLSLGCSLSLL | 45 | PRIMARY | 23 |
---|
![]() |
Primer_f | AGCAGGCCAATAGCACTTAGC |
---|---|
Primer_r | TCTATCTGTCCACCATCTTGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |