KIAA1402

Product ID	ORK00227
Accession No	AB037823
Description	chondroitin polymerizing factor 2, transcript variant 1
Clone name	hk09846
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3970 bp) Predicted protein sequence (788 aa)
HaloTag ORF Clone	FHC00227
Flexi ORF Clone	FXC00227
Source	Human adult brain
Rouge ID	mKIAA1402 by Kazusa Mouse cDNA Project

Length: 3970 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	138 bp
Genome contig ID	gi89161213f_150460518
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TAAATATGAAAATGTTATTAAACATGTCTTCTGCC
Flanking genome sequence (106322 - 106371)	----+--------+--------+--------+--------+----* AAACTGTTTTTAGGTCTAGGGAAAATTGAGTAAGGAGAAGAATCCAAGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	150560518	150566838	4	100.0	Perfect prediction

Length: 788 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2E5	100.0	Chondroitin sul...	Homo sapiens
XP_001140842	99.6	chondroitin sul...	Pan troglodytes
XP_001104211	99.5	similar to chon...	Macaca mulatta
XP_001504714	97.9	similar to chon...	Equus caballus
XP_539923	96.7	similar to chon...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023207	4.3e-14	25.2	KIAA0990

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008428	258	775	PF05679	Chondroitin N-acetylgalactosaminyltransferase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	23	LALLRPALPLILGLSLGCSLSLL	45	PRIMARY	23

Primer_f	AGCAGGCCAATAGCACTTAGC
Primer_r	TCTATCTGTCCACCATCTTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-